Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635824_at:

>probe:Drosophila_2:1635824_at:123:429; Interrogation_Position=1845; Antisense; GAGTTCAGCTACGAGTTGTCCAAGT
>probe:Drosophila_2:1635824_at:528:45; Interrogation_Position=1886; Antisense; ATCGCCGGAGAAACCATTGTCTGAT
>probe:Drosophila_2:1635824_at:511:605; Interrogation_Position=1907; Antisense; TGATCTGGGTTTGCTGTCCTATCGA
>probe:Drosophila_2:1635824_at:317:503; Interrogation_Position=1922; Antisense; GTCCTATCGATCGTACTGGGCGCAA
>probe:Drosophila_2:1635824_at:657:35; Interrogation_Position=1959; Antisense; ATCTTTATCAGCCAAAACCCGAGCA
>probe:Drosophila_2:1635824_at:571:605; Interrogation_Position=2053; Antisense; TGATCTCAACGCTGCAGAACCTGAA
>probe:Drosophila_2:1635824_at:406:161; Interrogation_Position=2092; Antisense; ACAAGGGCCAGTACATCGTGTGCAT
>probe:Drosophila_2:1635824_at:37:43; Interrogation_Position=2106; Antisense; ATCGTGTGCATCAACCGGGTTATCA
>probe:Drosophila_2:1635824_at:249:475; Interrogation_Position=2124; Antisense; GTTATCATCGAGCAACACCGGCGAG
>probe:Drosophila_2:1635824_at:151:361; Interrogation_Position=2161; Antisense; GCAAGATCCGCATCGACTCGAAATG
>probe:Drosophila_2:1635824_at:380:535; Interrogation_Position=2209; Antisense; GGTCCAAGCGCTCCAAATGATTTCC
>probe:Drosophila_2:1635824_at:370:459; Interrogation_Position=2227; Antisense; GATTTCCGCTACCAATATTCTTCAT
>probe:Drosophila_2:1635824_at:391:631; Interrogation_Position=2259; Antisense; TCCTGGCTTCGTTGTAGCTTGTAGT
>probe:Drosophila_2:1635824_at:264:21; Interrogation_Position=2342; Antisense; ATATACTTTTGAGACGACCGGCTAG

Paste this into a BLAST search page for me
GAGTTCAGCTACGAGTTGTCCAAGTATCGCCGGAGAAACCATTGTCTGATTGATCTGGGTTTGCTGTCCTATCGAGTCCTATCGATCGTACTGGGCGCAAATCTTTATCAGCCAAAACCCGAGCATGATCTCAACGCTGCAGAACCTGAAACAAGGGCCAGTACATCGTGTGCATATCGTGTGCATCAACCGGGTTATCAGTTATCATCGAGCAACACCGGCGAGGCAAGATCCGCATCGACTCGAAATGGGTCCAAGCGCTCCAAATGATTTCCGATTTCCGCTACCAATATTCTTCATTCCTGGCTTCGTTGTAGCTTGTAGTATATACTTTTGAGACGACCGGCTAG

Full Affymetrix probeset data:

Annotations for 1635824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime