Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635825_a_at:

>probe:Drosophila_2:1635825_a_at:138:675; Interrogation_Position=1052; Antisense; TAGCCAGCCAGCATAAGTTTAACTT
>probe:Drosophila_2:1635825_a_at:86:489; Interrogation_Position=509; Antisense; GTACGATGCCACACTCACGGAGGAG
>probe:Drosophila_2:1635825_a_at:83:123; Interrogation_Position=535; Antisense; AGCGGGCCGAGATCAAGCAGCTCAA
>probe:Drosophila_2:1635825_a_at:298:209; Interrogation_Position=558; Antisense; AAGCAGGACCTCGTTGACGCCAAGG
>probe:Drosophila_2:1635825_a_at:59:463; Interrogation_Position=652; Antisense; GATTCATCGCCAGCGAACGTATCAA
>probe:Drosophila_2:1635825_a_at:66:199; Interrogation_Position=667; Antisense; AACGTATCAACACTCCGCAGGGCGA
>probe:Drosophila_2:1635825_a_at:657:159; Interrogation_Position=691; Antisense; ACAAGCAAACCTACCGCGAGTGGCA
>probe:Drosophila_2:1635825_a_at:71:635; Interrogation_Position=740; Antisense; TCGCCTTTCCGACTCCGAGAAGGAG
>probe:Drosophila_2:1635825_a_at:65:259; Interrogation_Position=849; Antisense; CACATCGACGTGGTGCGTCACGGAA
>probe:Drosophila_2:1635825_a_at:12:561; Interrogation_Position=870; Antisense; GGAAATCTTATCGATCCACCTGAGC
>probe:Drosophila_2:1635825_a_at:278:299; Interrogation_Position=910; Antisense; CGCTGGCCTCCAAAGATATATAGTT
>probe:Drosophila_2:1635825_a_at:599:687; Interrogation_Position=926; Antisense; TATATAGTTGTAGCTGCTCGGCCCG
>probe:Drosophila_2:1635825_a_at:197:345; Interrogation_Position=981; Antisense; GCATCATTCTGTTTTTCGTTTTTCT
>probe:Drosophila_2:1635825_a_at:585:477; Interrogation_Position=998; Antisense; GTTTTTCTTTTTCGATCGCCAATTG

Paste this into a BLAST search page for me
TAGCCAGCCAGCATAAGTTTAACTTGTACGATGCCACACTCACGGAGGAGAGCGGGCCGAGATCAAGCAGCTCAAAAGCAGGACCTCGTTGACGCCAAGGGATTCATCGCCAGCGAACGTATCAAAACGTATCAACACTCCGCAGGGCGAACAAGCAAACCTACCGCGAGTGGCATCGCCTTTCCGACTCCGAGAAGGAGCACATCGACGTGGTGCGTCACGGAAGGAAATCTTATCGATCCACCTGAGCCGCTGGCCTCCAAAGATATATAGTTTATATAGTTGTAGCTGCTCGGCCCGGCATCATTCTGTTTTTCGTTTTTCTGTTTTTCTTTTTCGATCGCCAATTG

Full Affymetrix probeset data:

Annotations for 1635825_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime