FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635828_at:

>probe:Drosophila_2:1635828_at:291:19; Interrogation_Position=1000; Antisense; ATTTGTATTCCAATTGACCAGGCGT
>probe:Drosophila_2:1635828_at:706:413; Interrogation_Position=1015; Antisense; GACCAGGCGTATGCTGTTATGTAAT
>probe:Drosophila_2:1635828_at:613:489; Interrogation_Position=1071; Antisense; GTACTCGTACATACGGATCTTAGGA
>probe:Drosophila_2:1635828_at:59:693; Interrogation_Position=1117; Antisense; TTTGCATTCGCAACACGATCGTTTT
>probe:Drosophila_2:1635828_at:349:445; Interrogation_Position=1133; Antisense; GATCGTTTTGCATACTTTCGTTCTA
>probe:Drosophila_2:1635828_at:723:687; Interrogation_Position=1156; Antisense; TATATAAACCGCACTCAGCTTCATC
>probe:Drosophila_2:1635828_at:496:647; Interrogation_Position=1176; Antisense; TCATCCTTGTGCCATCGAAGACAGT
>probe:Drosophila_2:1635828_at:581:369; Interrogation_Position=1275; Antisense; GAATGTGTCTTCTATCTCGTAGAGT
>probe:Drosophila_2:1635828_at:679:457; Interrogation_Position=1312; Antisense; GTTGTTTCGAACTAACCACCTGAAT
>probe:Drosophila_2:1635828_at:284:515; Interrogation_Position=1404; Antisense; GTGTTACACACTTTTGAATGATCTA
>probe:Drosophila_2:1635828_at:636:35; Interrogation_Position=877; Antisense; ATCTTACGACGCAGCCGCTTTTGGG
>probe:Drosophila_2:1635828_at:666:721; Interrogation_Position=902; Antisense; TTCCACACACTTTTCACGTTTTGAG
>probe:Drosophila_2:1635828_at:375:723; Interrogation_Position=922; Antisense; TTGAGCTAGATTTGGGTAGAGCCCC
>probe:Drosophila_2:1635828_at:633:485; Interrogation_Position=937; Antisense; GTAGAGCCCCTGAATGATATGATAT

Paste this into a BLAST search page for me
ATTTGTATTCCAATTGACCAGGCGTGACCAGGCGTATGCTGTTATGTAATGTACTCGTACATACGGATCTTAGGATTTGCATTCGCAACACGATCGTTTTGATCGTTTTGCATACTTTCGTTCTATATATAAACCGCACTCAGCTTCATCTCATCCTTGTGCCATCGAAGACAGTGAATGTGTCTTCTATCTCGTAGAGTGTTGTTTCGAACTAACCACCTGAATGTGTTACACACTTTTGAATGATCTAATCTTACGACGCAGCCGCTTTTGGGTTCCACACACTTTTCACGTTTTGAGTTGAGCTAGATTTGGGTAGAGCCCCGTAGAGCCCCTGAATGATATGATAT

Full Affymetrix probeset data:

Annotations for 1635828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720