FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635830_at:

>probe:Drosophila_2:1635830_at:613:407; Interrogation_Position=1000; Antisense; GACGGATTGATCATGGACACCACGA
>probe:Drosophila_2:1635830_at:384:593; Interrogation_Position=1033; Antisense; TGGGCTACGCCCTCGATGAGATGGT
>probe:Drosophila_2:1635830_at:174:49; Interrogation_Position=1086; Antisense; ATCCAGATGACCGATCCGCGCGATA
>probe:Drosophila_2:1635830_at:465:23; Interrogation_Position=1108; Antisense; ATACTCTGGTAGTGGTCACCGCCGA
>probe:Drosophila_2:1635830_at:466:293; Interrogation_Position=1130; Antisense; CGATCATTCGCATACGCTTAGCATG
>probe:Drosophila_2:1635830_at:179:29; Interrogation_Position=1141; Antisense; ATACGCTTAGCATGTCGGGATACGC
>probe:Drosophila_2:1635830_at:718:63; Interrogation_Position=1276; Antisense; ATGGACGTCGGGAGAGTCCCAGCAA
>probe:Drosophila_2:1635830_at:468:503; Interrogation_Position=1291; Antisense; GTCCCAGCAAGACATTGAGTCCCAC
>probe:Drosophila_2:1635830_at:121:667; Interrogation_Position=1320; Antisense; TACACACCCAGCTATATTCATGGAA
>probe:Drosophila_2:1635830_at:538:63; Interrogation_Position=1369; Antisense; ATGTGGTCGTGTTTGCAATGGGCCC
>probe:Drosophila_2:1635830_at:14:271; Interrogation_Position=1401; Antisense; CATCTGTTCGGTGGCGTCATGGAGC
>probe:Drosophila_2:1635830_at:256:273; Interrogation_Position=1440; Antisense; CATATAATGGGCTATGCCGCCTGTC
>probe:Drosophila_2:1635830_at:302:651; Interrogation_Position=1477; Antisense; TCACTCTCTGCAACCAGGACAAGGA
>probe:Drosophila_2:1635830_at:487:447; Interrogation_Position=1500; Antisense; GATGCGGATATGATTGCCTGATTTT

Paste this into a BLAST search page for me
GACGGATTGATCATGGACACCACGATGGGCTACGCCCTCGATGAGATGGTATCCAGATGACCGATCCGCGCGATAATACTCTGGTAGTGGTCACCGCCGACGATCATTCGCATACGCTTAGCATGATACGCTTAGCATGTCGGGATACGCATGGACGTCGGGAGAGTCCCAGCAAGTCCCAGCAAGACATTGAGTCCCACTACACACCCAGCTATATTCATGGAAATGTGGTCGTGTTTGCAATGGGCCCCATCTGTTCGGTGGCGTCATGGAGCCATATAATGGGCTATGCCGCCTGTCTCACTCTCTGCAACCAGGACAAGGAGATGCGGATATGATTGCCTGATTTT

Full Affymetrix probeset data:

Annotations for 1635830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720