FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635831_at:

>probe:Drosophila_2:1635831_at:493:105; Interrogation_Position=101; Antisense; AGAAGAACTACTGTGGACCGCCGCT
>probe:Drosophila_2:1635831_at:123:521; Interrogation_Position=113; Antisense; GTGGACCGCCGCTGCAGACCTGCAA
>probe:Drosophila_2:1635831_at:587:103; Interrogation_Position=128; Antisense; AGACCTGCAAGTACAACGCCACACA
>probe:Drosophila_2:1635831_at:218:377; Interrogation_Position=171; Antisense; GAAGCATCTGAAGGAGTGTGACTAC
>probe:Drosophila_2:1635831_at:297:291; Interrogation_Position=18; Antisense; CGATTTCGAGTACGGAATTTGCCCT
>probe:Drosophila_2:1635831_at:628:433; Interrogation_Position=184; Antisense; GAGTGTGACTACTATCTCCGCAGCA
>probe:Drosophila_2:1635831_at:691:683; Interrogation_Position=196; Antisense; TATCTCCGCAGCATCGAAAACCAGG
>probe:Drosophila_2:1635831_at:532:175; Interrogation_Position=213; Antisense; AAACCAGGCGGTGCAGATAGCGCTT
>probe:Drosophila_2:1635831_at:27:97; Interrogation_Position=227; Antisense; AGATAGCGCTTCGTAGTCGCATACC
>probe:Drosophila_2:1635831_at:11:293; Interrogation_Position=238; Antisense; CGTAGTCGCATACCGCCCAAACAGG
>probe:Drosophila_2:1635831_at:638:429; Interrogation_Position=25; Antisense; GAGTACGGAATTTGCCCTTACGACA
>probe:Drosophila_2:1635831_at:688:557; Interrogation_Position=268; Antisense; GGACATGATGTGGACACACCATTTT
>probe:Drosophila_2:1635831_at:492:669; Interrogation_Position=43; Antisense; TACGACAAATCGCACCGCATCTTGC
>probe:Drosophila_2:1635831_at:72:721; Interrogation_Position=70; Antisense; TTCCGGATGCCCAAGCACTTAATTA

Paste this into a BLAST search page for me
AGAAGAACTACTGTGGACCGCCGCTGTGGACCGCCGCTGCAGACCTGCAAAGACCTGCAAGTACAACGCCACACAGAAGCATCTGAAGGAGTGTGACTACCGATTTCGAGTACGGAATTTGCCCTGAGTGTGACTACTATCTCCGCAGCATATCTCCGCAGCATCGAAAACCAGGAAACCAGGCGGTGCAGATAGCGCTTAGATAGCGCTTCGTAGTCGCATACCCGTAGTCGCATACCGCCCAAACAGGGAGTACGGAATTTGCCCTTACGACAGGACATGATGTGGACACACCATTTTTACGACAAATCGCACCGCATCTTGCTTCCGGATGCCCAAGCACTTAATTA

Full Affymetrix probeset data:

Annotations for 1635831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720