FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635832_at:

>probe:Drosophila_2:1635832_at:64:273; Interrogation_Position=1598; Antisense; CATACTTGATGTGCTGGAGACCTAT
>probe:Drosophila_2:1635832_at:597:111; Interrogation_Position=1626; Antisense; AGCAACGAGAGCTGCCGCCTGGATA
>probe:Drosophila_2:1635832_at:590:317; Interrogation_Position=1642; Antisense; GCCTGGATATCGTTCACTATGGCGT
>probe:Drosophila_2:1635832_at:74:227; Interrogation_Position=1701; Antisense; AAGGCTTTCCATGCCATTATCTATG
>probe:Drosophila_2:1635832_at:61:703; Interrogation_Position=1717; Antisense; TTATCTATGCCTTCGCAGTGGAGAC
>probe:Drosophila_2:1635832_at:402:135; Interrogation_Position=1775; Antisense; ACGAAGCTACAACATCATCTACCGG
>probe:Drosophila_2:1635832_at:89:39; Interrogation_Position=1791; Antisense; ATCTACCGGCTAATCGACGATCTGA
>probe:Drosophila_2:1635832_at:713:349; Interrogation_Position=1828; Antisense; GCAGTAAGTTGCCTCCAGTGGAAGT
>probe:Drosophila_2:1635832_at:151:595; Interrogation_Position=1864; Antisense; TGGGCGAGGCCAATGTCCTGCAAAA
>probe:Drosophila_2:1635832_at:33:599; Interrogation_Position=1877; Antisense; TGTCCTGCAAAACTTCCTCATCAAT
>probe:Drosophila_2:1635832_at:6:185; Interrogation_Position=1966; Antisense; AAAAGTTCCGCCTCTTGCGTGATGG
>probe:Drosophila_2:1635832_at:283:65; Interrogation_Position=1987; Antisense; ATGGAGAGGTTGTCTACGATGGCCC
>probe:Drosophila_2:1635832_at:324:623; Interrogation_Position=2070; Antisense; TGCGGACTACGCTTCAGAGACACCA
>probe:Drosophila_2:1635832_at:105:459; Interrogation_Position=2115; Antisense; GATATACTGCAGTGCTACACCACCA

Paste this into a BLAST search page for me
CATACTTGATGTGCTGGAGACCTATAGCAACGAGAGCTGCCGCCTGGATAGCCTGGATATCGTTCACTATGGCGTAAGGCTTTCCATGCCATTATCTATGTTATCTATGCCTTCGCAGTGGAGACACGAAGCTACAACATCATCTACCGGATCTACCGGCTAATCGACGATCTGAGCAGTAAGTTGCCTCCAGTGGAAGTTGGGCGAGGCCAATGTCCTGCAAAATGTCCTGCAAAACTTCCTCATCAATAAAAGTTCCGCCTCTTGCGTGATGGATGGAGAGGTTGTCTACGATGGCCCTGCGGACTACGCTTCAGAGACACCAGATATACTGCAGTGCTACACCACCA

Full Affymetrix probeset data:

Annotations for 1635832_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720