Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635833_at:

>probe:Drosophila_2:1635833_at:169:199; Interrogation_Position=1353; Antisense; AACGATGAACTGCAGCTGGATTCGC
>probe:Drosophila_2:1635833_at:318:543; Interrogation_Position=1370; Antisense; GGATTCGCAGTCCAATTCGAGTAGG
>probe:Drosophila_2:1635833_at:369:231; Interrogation_Position=1409; Antisense; AATGATGCTGTCGTGGTTCGGCGCC
>probe:Drosophila_2:1635833_at:544:79; Interrogation_Position=1477; Antisense; AGGTGCCCAGTCACTACGATTGCGA
>probe:Drosophila_2:1635833_at:139:557; Interrogation_Position=1517; Antisense; GGACGATATGCCAACGCCAACTGTG
>probe:Drosophila_2:1635833_at:586:195; Interrogation_Position=1535; Antisense; AACTGTGTGCCGTCGACAGCGCATG
>probe:Drosophila_2:1635833_at:634:355; Interrogation_Position=1634; Antisense; GCACTGCAGCACACATCTATTTTTT
>probe:Drosophila_2:1635833_at:337:617; Interrogation_Position=1714; Antisense; TGCAGCGCCTGCAAAGTTCACTTAT
>probe:Drosophila_2:1635833_at:142:93; Interrogation_Position=1728; Antisense; AGTTCACTTATTTGGCATGCTACGC
>probe:Drosophila_2:1635833_at:412:569; Interrogation_Position=1741; Antisense; GGCATGCTACGCTAGTTTTGGCTTA
>probe:Drosophila_2:1635833_at:667:697; Interrogation_Position=1756; Antisense; TTTTGGCTTAGAATTCCCGGCCCAT
>probe:Drosophila_2:1635833_at:609:269; Interrogation_Position=1778; Antisense; CATCCTGTCCAGAAGTTGTGCACGT
>probe:Drosophila_2:1635833_at:493:597; Interrogation_Position=1794; Antisense; TGTGCACGTGCACTTGGCTGGCAAC
>probe:Drosophila_2:1635833_at:166:585; Interrogation_Position=1812; Antisense; TGGCAACCTTTTCGCATCTTTATTT

Paste this into a BLAST search page for me
AACGATGAACTGCAGCTGGATTCGCGGATTCGCAGTCCAATTCGAGTAGGAATGATGCTGTCGTGGTTCGGCGCCAGGTGCCCAGTCACTACGATTGCGAGGACGATATGCCAACGCCAACTGTGAACTGTGTGCCGTCGACAGCGCATGGCACTGCAGCACACATCTATTTTTTTGCAGCGCCTGCAAAGTTCACTTATAGTTCACTTATTTGGCATGCTACGCGGCATGCTACGCTAGTTTTGGCTTATTTTGGCTTAGAATTCCCGGCCCATCATCCTGTCCAGAAGTTGTGCACGTTGTGCACGTGCACTTGGCTGGCAACTGGCAACCTTTTCGCATCTTTATTT

Full Affymetrix probeset data:

Annotations for 1635833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime