FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635834_at:

>probe:Drosophila_2:1635834_at:496:167; Interrogation_Position=105; Antisense; AAAGGCCGTCGATGAGAACACTTAC
>probe:Drosophila_2:1635834_at:331:107; Interrogation_Position=119; Antisense; AGAACACTTACGTGGTGGCCGCTGC
>probe:Drosophila_2:1635834_at:688:521; Interrogation_Position=133; Antisense; GTGGCCGCTGCACCATCAAAGCGAT
>probe:Drosophila_2:1635834_at:200:207; Interrogation_Position=151; Antisense; AAGCGATCGAAGAAGTGCGGCAATC
>probe:Drosophila_2:1635834_at:699:235; Interrogation_Position=172; Antisense; AATCGCATAAGCTTCGAGCCGGGCC
>probe:Drosophila_2:1635834_at:224:407; Interrogation_Position=187; Antisense; GAGCCGGGCCTTTTAAGGAACTGCA
>probe:Drosophila_2:1635834_at:43:227; Interrogation_Position=201; Antisense; AAGGAACTGCAAGACGAGAGATCAA
>probe:Drosophila_2:1635834_at:546:425; Interrogation_Position=216; Antisense; GAGAGATCAAATGCGACCTCTGATT
>probe:Drosophila_2:1635834_at:492:165; Interrogation_Position=224; Antisense; AAATGCGACCTCTGATTAATAAAGT
>probe:Drosophila_2:1635834_at:98:495; Interrogation_Position=27; Antisense; GTCACCCATCGCACAGGACAAGGTT
>probe:Drosophila_2:1635834_at:589:73; Interrogation_Position=41; Antisense; AGGACAAGGTTGTGGTCACCCCGCA
>probe:Drosophila_2:1635834_at:287:537; Interrogation_Position=54; Antisense; GGTCACCCCGCAGAAGCTTAGAGAA
>probe:Drosophila_2:1635834_at:712:571; Interrogation_Position=81; Antisense; GGCTGACTTTAAGGCCATGATCCAA
>probe:Drosophila_2:1635834_at:192:315; Interrogation_Position=94; Antisense; GCCATGATCCAAAAGGCCGTCGATG

Paste this into a BLAST search page for me
AAAGGCCGTCGATGAGAACACTTACAGAACACTTACGTGGTGGCCGCTGCGTGGCCGCTGCACCATCAAAGCGATAAGCGATCGAAGAAGTGCGGCAATCAATCGCATAAGCTTCGAGCCGGGCCGAGCCGGGCCTTTTAAGGAACTGCAAAGGAACTGCAAGACGAGAGATCAAGAGAGATCAAATGCGACCTCTGATTAAATGCGACCTCTGATTAATAAAGTGTCACCCATCGCACAGGACAAGGTTAGGACAAGGTTGTGGTCACCCCGCAGGTCACCCCGCAGAAGCTTAGAGAAGGCTGACTTTAAGGCCATGATCCAAGCCATGATCCAAAAGGCCGTCGATG

Full Affymetrix probeset data:

Annotations for 1635834_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720