FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635835_at:

>probe:Drosophila_2:1635835_at:188:159; Interrogation_Position=109; Antisense; ACACACTGTGTGATTTCCGGATGGG
>probe:Drosophila_2:1635835_at:166:261; Interrogation_Position=15; Antisense; CACCTGTTGTTGTCTATACCTGGAG
>probe:Drosophila_2:1635835_at:196:559; Interrogation_Position=227; Antisense; GGAAAACCAGGTTTCAGCTTGCCAC
>probe:Drosophila_2:1635835_at:111:723; Interrogation_Position=245; Antisense; TTGCCACCAGTCTCATATGTGTCAG
>probe:Drosophila_2:1635835_at:266:27; Interrogation_Position=30; Antisense; ATACCTGGAGTCTACATTTGCATTT
>probe:Drosophila_2:1635835_at:565:37; Interrogation_Position=313; Antisense; ATCTTGGTTTGTTCCCCTGACGCAA
>probe:Drosophila_2:1635835_at:336:645; Interrogation_Position=338; Antisense; TCTTCGCTAGATATCACCAGGTCGG
>probe:Drosophila_2:1635835_at:146:501; Interrogation_Position=379; Antisense; GTCGATTGCGGCAGGCCAAACGTTT
>probe:Drosophila_2:1635835_at:478:477; Interrogation_Position=400; Antisense; GTTTCCTCGACCTTCAAAAATGTGT
>probe:Drosophila_2:1635835_at:2:543; Interrogation_Position=440; Antisense; GGATTGATCGCAACTTTCCAAGCAA
>probe:Drosophila_2:1635835_at:473:81; Interrogation_Position=467; Antisense; CGGTGGAACCGCTTAGGAACTGTAT
>probe:Drosophila_2:1635835_at:79:681; Interrogation_Position=495; Antisense; TATCCACCCAAGAATTTCGTCCTAT
>probe:Drosophila_2:1635835_at:322:39; Interrogation_Position=73; Antisense; ATCTGCTTACCTCTTCAAGGGTCGT
>probe:Drosophila_2:1635835_at:608:531; Interrogation_Position=91; Antisense; GGGTCGTCCATTGAGCAGACACACT

Paste this into a BLAST search page for me
ACACACTGTGTGATTTCCGGATGGGCACCTGTTGTTGTCTATACCTGGAGGGAAAACCAGGTTTCAGCTTGCCACTTGCCACCAGTCTCATATGTGTCAGATACCTGGAGTCTACATTTGCATTTATCTTGGTTTGTTCCCCTGACGCAATCTTCGCTAGATATCACCAGGTCGGGTCGATTGCGGCAGGCCAAACGTTTGTTTCCTCGACCTTCAAAAATGTGTGGATTGATCGCAACTTTCCAAGCAACGGTGGAACCGCTTAGGAACTGTATTATCCACCCAAGAATTTCGTCCTATATCTGCTTACCTCTTCAAGGGTCGTGGGTCGTCCATTGAGCAGACACACT

Full Affymetrix probeset data:

Annotations for 1635835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720