FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635836_at:

>probe:Drosophila_2:1635836_at:110:283; Interrogation_Position=157; Antisense; CTGCGTTTTCATGGCCTGGTGAACA
>probe:Drosophila_2:1635836_at:417:385; Interrogation_Position=177; Antisense; GAACATGGCCTATTTCCGTGAGTAT
>probe:Drosophila_2:1635836_at:548:511; Interrogation_Position=194; Antisense; GTGAGTATTTGCTGGGTCTCCACAA
>probe:Drosophila_2:1635836_at:525:191; Interrogation_Position=244; Antisense; AACTTGTTTGTCGACTTGCCACCTG
>probe:Drosophila_2:1635836_at:317:519; Interrogation_Position=310; Antisense; GTGGTTGCCGAATATCACCTGAAAC
>probe:Drosophila_2:1635836_at:323:337; Interrogation_Position=335; Antisense; GCTGCCAAATGGATCTGCCCGATGA
>probe:Drosophila_2:1635836_at:160:523; Interrogation_Position=367; Antisense; GTGGCCACCGATGATTTCTCAGAAC
>probe:Drosophila_2:1635836_at:157:109; Interrogation_Position=387; Antisense; AGAACCGCATTTCAACTACGCCGAG
>probe:Drosophila_2:1635836_at:163:557; Interrogation_Position=483; Antisense; GGACGAGCTCTACGATCTGGATGAT
>probe:Drosophila_2:1635836_at:45:45; Interrogation_Position=554; Antisense; ATCGCAGTTCCTATATGGGCTGTGC
>probe:Drosophila_2:1635836_at:127:31; Interrogation_Position=607; Antisense; ATACACTTTGTGCTCGTTTGCTATT
>probe:Drosophila_2:1635836_at:376:617; Interrogation_Position=625; Antisense; TGCTATTATAGCTCAGGACCACCTG
>probe:Drosophila_2:1635836_at:15:555; Interrogation_Position=640; Antisense; GGACCACCTGTCGAGGGAAACCTAT
>probe:Drosophila_2:1635836_at:18:201; Interrogation_Position=724; Antisense; AACCTTTGCAAAACACTGACCCTGA

Paste this into a BLAST search page for me
CTGCGTTTTCATGGCCTGGTGAACAGAACATGGCCTATTTCCGTGAGTATGTGAGTATTTGCTGGGTCTCCACAAAACTTGTTTGTCGACTTGCCACCTGGTGGTTGCCGAATATCACCTGAAACGCTGCCAAATGGATCTGCCCGATGAGTGGCCACCGATGATTTCTCAGAACAGAACCGCATTTCAACTACGCCGAGGGACGAGCTCTACGATCTGGATGATATCGCAGTTCCTATATGGGCTGTGCATACACTTTGTGCTCGTTTGCTATTTGCTATTATAGCTCAGGACCACCTGGGACCACCTGTCGAGGGAAACCTATAACCTTTGCAAAACACTGACCCTGA

Full Affymetrix probeset data:

Annotations for 1635836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720