Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635842_at:

>probe:Drosophila_2:1635842_at:721:673; Interrogation_Position=5397; Antisense; TAGCGACCCAAAACAAGCAGCCAAT
>probe:Drosophila_2:1635842_at:218:465; Interrogation_Position=5434; Antisense; GATTGATGTTTGGTCTCGCATTTGT
>probe:Drosophila_2:1635842_at:106:299; Interrogation_Position=5450; Antisense; CGCATTTGTGCGCAGCGTCAAAATT
>probe:Drosophila_2:1635842_at:510:183; Interrogation_Position=5469; Antisense; AAAATTCGCTTAGGGATTCCGCCAT
>probe:Drosophila_2:1635842_at:325:87; Interrogation_Position=5502; Antisense; AGTCCATGCAAATTGTGCTCTGCAA
>probe:Drosophila_2:1635842_at:291:509; Interrogation_Position=5516; Antisense; GTGCTCTGCAATGCTCACAATGTGC
>probe:Drosophila_2:1635842_at:450:177; Interrogation_Position=5546; Antisense; AAACGTGGCATAATGACCTCATATC
>probe:Drosophila_2:1635842_at:658:99; Interrogation_Position=5577; Antisense; AGATGGCGCCGCAGGTGACAGCCAA
>probe:Drosophila_2:1635842_at:217:157; Interrogation_Position=5616; Antisense; ACAAGGATCCGCTCAACGAGTTGGA
>probe:Drosophila_2:1635842_at:464:137; Interrogation_Position=5631; Antisense; ACGAGTTGGATGCACTTTGGAAGCT
>probe:Drosophila_2:1635842_at:465:491; Interrogation_Position=5659; Antisense; GTAAACGACTGAGCCAAGCAACCAA
>probe:Drosophila_2:1635842_at:519:707; Interrogation_Position=5727; Antisense; TTAACTGTGCAGACCTATTTCTAAA
>probe:Drosophila_2:1635842_at:584:483; Interrogation_Position=5826; Antisense; GTATCGTAAACGTCTCTTTCAACTG
>probe:Drosophila_2:1635842_at:696:205; Interrogation_Position=5908; Antisense; AAGCGTTTCAAACCACTGTACGAGT

Paste this into a BLAST search page for me
TAGCGACCCAAAACAAGCAGCCAATGATTGATGTTTGGTCTCGCATTTGTCGCATTTGTGCGCAGCGTCAAAATTAAAATTCGCTTAGGGATTCCGCCATAGTCCATGCAAATTGTGCTCTGCAAGTGCTCTGCAATGCTCACAATGTGCAAACGTGGCATAATGACCTCATATCAGATGGCGCCGCAGGTGACAGCCAAACAAGGATCCGCTCAACGAGTTGGAACGAGTTGGATGCACTTTGGAAGCTGTAAACGACTGAGCCAAGCAACCAATTAACTGTGCAGACCTATTTCTAAAGTATCGTAAACGTCTCTTTCAACTGAAGCGTTTCAAACCACTGTACGAGT

Full Affymetrix probeset data:

Annotations for 1635842_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime