Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635843_at:

>probe:Drosophila_2:1635843_at:230:321; Interrogation_Position=1780; Antisense; GCCGCCACCAATTGCTCAAGAGATT
>probe:Drosophila_2:1635843_at:322:465; Interrogation_Position=1801; Antisense; GATTGACATCCACGTAATTGACCTA
>probe:Drosophila_2:1635843_at:397:277; Interrogation_Position=1823; Antisense; CTAATGACTCTCAAGCGGGTGGGCA
>probe:Drosophila_2:1635843_at:48:125; Interrogation_Position=1880; Antisense; AGCGCGGAGTGCTTCTTTATCTTCC
>probe:Drosophila_2:1635843_at:98:455; Interrogation_Position=1943; Antisense; GATCAACATGCCTACCTGTGGGATA
>probe:Drosophila_2:1635843_at:384:79; Interrogation_Position=1967; Antisense; AGGTACTACGGCATCAGCCTAGCAA
>probe:Drosophila_2:1635843_at:578:539; Interrogation_Position=2011; Antisense; GGTTAACAGTGTGGCCTTCAATCCT
>probe:Drosophila_2:1635843_at:454:235; Interrogation_Position=2030; Antisense; AATCCTCGCGACTCGGAGATGCTGG
>probe:Drosophila_2:1635843_at:529:709; Interrogation_Position=2079; Antisense; TTAAGGTCTGGCGATCACGAGCAAA
>probe:Drosophila_2:1635843_at:395:241; Interrogation_Position=2117; Antisense; AATATCCCCATTAACGTCAGCGAAT
>probe:Drosophila_2:1635843_at:178:311; Interrogation_Position=2136; Antisense; GCGAATCCTTTGAGTTGAAGCCGAA
>probe:Drosophila_2:1635843_at:593:255; Interrogation_Position=2184; Antisense; CAAATCCCCAAGTGGTTCTTACTGC
>probe:Drosophila_2:1635843_at:601:645; Interrogation_Position=2200; Antisense; TCTTACTGCCTAAAAACACCGTCTT
>probe:Drosophila_2:1635843_at:422:285; Interrogation_Position=2232; Antisense; CTGAGTGCTTGCTAGTTGGTTCCAT

Paste this into a BLAST search page for me
GCCGCCACCAATTGCTCAAGAGATTGATTGACATCCACGTAATTGACCTACTAATGACTCTCAAGCGGGTGGGCAAGCGCGGAGTGCTTCTTTATCTTCCGATCAACATGCCTACCTGTGGGATAAGGTACTACGGCATCAGCCTAGCAAGGTTAACAGTGTGGCCTTCAATCCTAATCCTCGCGACTCGGAGATGCTGGTTAAGGTCTGGCGATCACGAGCAAAAATATCCCCATTAACGTCAGCGAATGCGAATCCTTTGAGTTGAAGCCGAACAAATCCCCAAGTGGTTCTTACTGCTCTTACTGCCTAAAAACACCGTCTTCTGAGTGCTTGCTAGTTGGTTCCAT

Full Affymetrix probeset data:

Annotations for 1635843_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime