FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635844_at:

>probe:Drosophila_2:1635844_at:192:689; Interrogation_Position=294; Antisense; TTTGTCGTGGGCGTGATCACCACCC
>probe:Drosophila_2:1635844_at:128:713; Interrogation_Position=330; Antisense; TTGACCGTCGTCTCCATCAAGGGAC
>probe:Drosophila_2:1635844_at:21:635; Interrogation_Position=337; Antisense; TCGTCTCCATCAAGGGACTGGGCGT
>probe:Drosophila_2:1635844_at:264:623; Interrogation_Position=379; Antisense; TGCTGGCCATCGGACAAATGCTGTC
>probe:Drosophila_2:1635844_at:529:559; Interrogation_Position=390; Antisense; GGACAAATGCTGTCCCGTGCTCTTC
>probe:Drosophila_2:1635844_at:418:133; Interrogation_Position=495; Antisense; ACCCAGCAGCCCGTCTGGTTGGAGA
>probe:Drosophila_2:1635844_at:494:459; Interrogation_Position=533; Antisense; GATTTGTTTCGGTTTTGGCTGACCA
>probe:Drosophila_2:1635844_at:564:571; Interrogation_Position=549; Antisense; GGCTGACCAGGATGACAATGCAAGA
>probe:Drosophila_2:1635844_at:550:359; Interrogation_Position=568; Antisense; GCAAGACCAGGGATAACGGCGAGCT
>probe:Drosophila_2:1635844_at:23:31; Interrogation_Position=580; Antisense; ATAACGGCGAGCTGGTAGCGAGTCA
>probe:Drosophila_2:1635844_at:702:581; Interrogation_Position=592; Antisense; TGGTAGCGAGTCAGGATTCAGATTT
>probe:Drosophila_2:1635844_at:421:543; Interrogation_Position=605; Antisense; GGATTCAGATTTACCTCAGCCTCAG
>probe:Drosophila_2:1635844_at:63:317; Interrogation_Position=623; Antisense; GCCTCAGCGAGCGTTCAACCAAATA
>probe:Drosophila_2:1635844_at:72:31; Interrogation_Position=755; Antisense; ATACAAATTAGTCTGCTGAATGAAG

Paste this into a BLAST search page for me
TTTGTCGTGGGCGTGATCACCACCCTTGACCGTCGTCTCCATCAAGGGACTCGTCTCCATCAAGGGACTGGGCGTTGCTGGCCATCGGACAAATGCTGTCGGACAAATGCTGTCCCGTGCTCTTCACCCAGCAGCCCGTCTGGTTGGAGAGATTTGTTTCGGTTTTGGCTGACCAGGCTGACCAGGATGACAATGCAAGAGCAAGACCAGGGATAACGGCGAGCTATAACGGCGAGCTGGTAGCGAGTCATGGTAGCGAGTCAGGATTCAGATTTGGATTCAGATTTACCTCAGCCTCAGGCCTCAGCGAGCGTTCAACCAAATAATACAAATTAGTCTGCTGAATGAAG

Full Affymetrix probeset data:

Annotations for 1635844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720