FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635845_at:

>probe:Drosophila_2:1635845_at:498:27; Interrogation_Position=2380; Antisense; ATACCACCGTCGAATCAGATACCAT
>probe:Drosophila_2:1635845_at:368:79; Interrogation_Position=2408; Antisense; AGGTGATTGTGGACCAACCAGTTCC
>probe:Drosophila_2:1635845_at:96:93; Interrogation_Position=2427; Antisense; AGTTCCATCTTCAACTTTCAAGCCA
>probe:Drosophila_2:1635845_at:378:43; Interrogation_Position=2494; Antisense; ATCGACGATCCTCCATTCGTAGAAG
>probe:Drosophila_2:1635845_at:66:373; Interrogation_Position=2530; Antisense; GAAGTGGTTGTTGAGTCCGCAAACA
>probe:Drosophila_2:1635845_at:574:227; Interrogation_Position=2554; Antisense; AATGGCCAAGTCACTGAGGTTATCG
>probe:Drosophila_2:1635845_at:553:373; Interrogation_Position=2587; Antisense; GAAGAGATCATACAACCCGTCACAC
>probe:Drosophila_2:1635845_at:189:651; Interrogation_Position=2606; Antisense; TCACACCCATCGGAACTGTTTTGGT
>probe:Drosophila_2:1635845_at:457:121; Interrogation_Position=2669; Antisense; AGCGATATTCCCTAAGTGCGACACT
>probe:Drosophila_2:1635845_at:178:559; Interrogation_Position=2727; Antisense; GGAAACGAATCAGTCACCACCGATC
>probe:Drosophila_2:1635845_at:221:129; Interrogation_Position=2775; Antisense; ACCACCGAAGCGTAGATGTTGCCAG
>probe:Drosophila_2:1635845_at:221:523; Interrogation_Position=2833; Antisense; GGGCTTTCCCCAAGGCAAGTGAATC
>probe:Drosophila_2:1635845_at:413:531; Interrogation_Position=2900; Antisense; GGGTCTTTTTATTATCAGCCTGGGA
>probe:Drosophila_2:1635845_at:310:593; Interrogation_Position=2920; Antisense; TGGGAATGTAAGCTCCACCTATCGC

Paste this into a BLAST search page for me
ATACCACCGTCGAATCAGATACCATAGGTGATTGTGGACCAACCAGTTCCAGTTCCATCTTCAACTTTCAAGCCAATCGACGATCCTCCATTCGTAGAAGGAAGTGGTTGTTGAGTCCGCAAACAAATGGCCAAGTCACTGAGGTTATCGGAAGAGATCATACAACCCGTCACACTCACACCCATCGGAACTGTTTTGGTAGCGATATTCCCTAAGTGCGACACTGGAAACGAATCAGTCACCACCGATCACCACCGAAGCGTAGATGTTGCCAGGGGCTTTCCCCAAGGCAAGTGAATCGGGTCTTTTTATTATCAGCCTGGGATGGGAATGTAAGCTCCACCTATCGC

Full Affymetrix probeset data:

Annotations for 1635845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720