FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635847_at:

>probe:Drosophila_2:1635847_at:574:281; Interrogation_Position=191; Antisense; CGGTGACCACCCAGGACGGAGAGCT
>probe:Drosophila_2:1635847_at:101:611; Interrogation_Position=224; Antisense; TGACCGGACAGGGATTCGGTGACCT
>probe:Drosophila_2:1635847_at:517:79; Interrogation_Position=233; Antisense; AGGGATTCGGTGACCTGACCCGTCT
>probe:Drosophila_2:1635847_at:557:385; Interrogation_Position=244; Antisense; GACCTGACCCGTCTCCGTAAGTCTG
>probe:Drosophila_2:1635847_at:410:493; Interrogation_Position=260; Antisense; GTAAGTCTGCCTACGGCGGCAGCTC
>probe:Drosophila_2:1635847_at:107:571; Interrogation_Position=289; Antisense; GGCTATGGCGGCTCCAGCATCCCAG
>probe:Drosophila_2:1635847_at:365:113; Interrogation_Position=467; Antisense; AGCAGCAGCTGTACAGCGCCTACGT
>probe:Drosophila_2:1635847_at:271:309; Interrogation_Position=495; Antisense; CCAGACCTATGGCTACCAGTACTAA
>probe:Drosophila_2:1635847_at:358:265; Interrogation_Position=511; Antisense; CAGTACTAAGCACCTGCTCCGACTG
>probe:Drosophila_2:1635847_at:335:623; Interrogation_Position=534; Antisense; TGCGACTGCGATCATCGCCCAAGGA
>probe:Drosophila_2:1635847_at:387:225; Interrogation_Position=554; Antisense; AAGGACCACGAACCGACTGCCGAGA
>probe:Drosophila_2:1635847_at:18:407; Interrogation_Position=568; Antisense; GACTGCCGAGAAACATAAGCTTTGA
>probe:Drosophila_2:1635847_at:135:277; Interrogation_Position=73; Antisense; CTTCAACCACCAACAACCAAGATGA
>probe:Drosophila_2:1635847_at:658:55; Interrogation_Position=94; Antisense; ATGAAATCCTTCGTGTGCATCGCTC

Paste this into a BLAST search page for me
CGGTGACCACCCAGGACGGAGAGCTTGACCGGACAGGGATTCGGTGACCTAGGGATTCGGTGACCTGACCCGTCTGACCTGACCCGTCTCCGTAAGTCTGGTAAGTCTGCCTACGGCGGCAGCTCGGCTATGGCGGCTCCAGCATCCCAGAGCAGCAGCTGTACAGCGCCTACGTCCAGACCTATGGCTACCAGTACTAACAGTACTAAGCACCTGCTCCGACTGTGCGACTGCGATCATCGCCCAAGGAAAGGACCACGAACCGACTGCCGAGAGACTGCCGAGAAACATAAGCTTTGACTTCAACCACCAACAACCAAGATGAATGAAATCCTTCGTGTGCATCGCTC

Full Affymetrix probeset data:

Annotations for 1635847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720