Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635848_at:

>probe:Drosophila_2:1635848_at:686:631; Interrogation_Position=1754; Antisense; TCCGTGGAATCGGTCACCAATGGAA
>probe:Drosophila_2:1635848_at:445:211; Interrogation_Position=1778; Antisense; AAGAAGCTCCATGCCAATGGACACT
>probe:Drosophila_2:1635848_at:625:585; Interrogation_Position=1795; Antisense; TGGACACTCCAATGGGTCCGCCAAG
>probe:Drosophila_2:1635848_at:237:121; Interrogation_Position=1818; Antisense; AGCTGGCCACTAACGGCAATGGTCA
>probe:Drosophila_2:1635848_at:253:229; Interrogation_Position=1835; Antisense; AATGGTCACTGATGGATGGCCGCAT
>probe:Drosophila_2:1635848_at:495:297; Interrogation_Position=1855; Antisense; CGCATCCCTGATTTTCGATCGGAAT
>probe:Drosophila_2:1635848_at:50:403; Interrogation_Position=1926; Antisense; GACTTAAGCTACTATTACTAACTGA
>probe:Drosophila_2:1635848_at:151:677; Interrogation_Position=1976; Antisense; TAGACTGTTGTCTGTATACCACAAA
>probe:Drosophila_2:1635848_at:354:21; Interrogation_Position=2005; Antisense; ATATTTATTTCTTATGAGCACGATC
>probe:Drosophila_2:1635848_at:263:421; Interrogation_Position=2020; Antisense; GAGCACGATCATATCATATCATATC
>probe:Drosophila_2:1635848_at:79:143; Interrogation_Position=2063; Antisense; ACTGGATATGGAACACATCTTCAAA
>probe:Drosophila_2:1635848_at:698:223; Interrogation_Position=2108; Antisense; AAGGAAGTTCCTGCATTGAAATACT
>probe:Drosophila_2:1635848_at:683:701; Interrogation_Position=2136; Antisense; TTAATATCCACGTTTAGCCTAAAAT
>probe:Drosophila_2:1635848_at:566:377; Interrogation_Position=2272; Antisense; GAAGCTTTTTGTTCTCATATTCCAA

Paste this into a BLAST search page for me
TCCGTGGAATCGGTCACCAATGGAAAAGAAGCTCCATGCCAATGGACACTTGGACACTCCAATGGGTCCGCCAAGAGCTGGCCACTAACGGCAATGGTCAAATGGTCACTGATGGATGGCCGCATCGCATCCCTGATTTTCGATCGGAATGACTTAAGCTACTATTACTAACTGATAGACTGTTGTCTGTATACCACAAAATATTTATTTCTTATGAGCACGATCGAGCACGATCATATCATATCATATCACTGGATATGGAACACATCTTCAAAAAGGAAGTTCCTGCATTGAAATACTTTAATATCCACGTTTAGCCTAAAATGAAGCTTTTTGTTCTCATATTCCAA

Full Affymetrix probeset data:

Annotations for 1635848_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime