FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635849_at:

>probe:Drosophila_2:1635849_at:170:33; Interrogation_Position=1013; Antisense; ATCAATACATATTTCCTGGCCTTCT
>probe:Drosophila_2:1635849_at:552:575; Interrogation_Position=1030; Antisense; GGCCTTCTGTTATCTCAACTTTTAC
>probe:Drosophila_2:1635849_at:335:131; Interrogation_Position=539; Antisense; ACCTGGGTCAGTTCGTGCCGAGCAT
>probe:Drosophila_2:1635849_at:469:129; Interrogation_Position=611; Antisense; ACCAGATGGGCATTTCCAGTGCCAA
>probe:Drosophila_2:1635849_at:412:227; Interrogation_Position=634; Antisense; AAGGCGACCAAGGACACCGGTATCT
>probe:Drosophila_2:1635849_at:117:305; Interrogation_Position=650; Antisense; CCGGTATCTGGGTGGGTGACAACAA
>probe:Drosophila_2:1635849_at:725:185; Interrogation_Position=670; Antisense; AACAAGATCTGTGCCATCGGTATCC
>probe:Drosophila_2:1635849_at:122:471; Interrogation_Position=704; Antisense; GTTACGTCACCACGCATGGAATCGG
>probe:Drosophila_2:1635849_at:602:65; Interrogation_Position=719; Antisense; ATGGAATCGGCCTCAATTGCTGCAC
>probe:Drosophila_2:1635849_at:229:259; Interrogation_Position=763; Antisense; CACATTGTGCCCTGCGGAATCGAAG
>probe:Drosophila_2:1635849_at:685:401; Interrogation_Position=824; Antisense; GACATTTTCCTGTCGAGGAGGCCAG
>probe:Drosophila_2:1635849_at:500:297; Interrogation_Position=852; Antisense; CGCACTCCTCAATAGTTTCGCTAAA
>probe:Drosophila_2:1635849_at:642:663; Interrogation_Position=873; Antisense; TAAAGTTTTCGAATGCCGCCTTCAG
>probe:Drosophila_2:1635849_at:529:553; Interrogation_Position=971; Antisense; GGACCGCCAAGTTTATTTCAACATT

Paste this into a BLAST search page for me
ATCAATACATATTTCCTGGCCTTCTGGCCTTCTGTTATCTCAACTTTTACACCTGGGTCAGTTCGTGCCGAGCATACCAGATGGGCATTTCCAGTGCCAAAAGGCGACCAAGGACACCGGTATCTCCGGTATCTGGGTGGGTGACAACAAAACAAGATCTGTGCCATCGGTATCCGTTACGTCACCACGCATGGAATCGGATGGAATCGGCCTCAATTGCTGCACCACATTGTGCCCTGCGGAATCGAAGGACATTTTCCTGTCGAGGAGGCCAGCGCACTCCTCAATAGTTTCGCTAAATAAAGTTTTCGAATGCCGCCTTCAGGGACCGCCAAGTTTATTTCAACATT

Full Affymetrix probeset data:

Annotations for 1635849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720