FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635851_at:

>probe:Drosophila_2:1635851_at:36:695; Interrogation_Position=103; Antisense; TTTCGCGATCTCCACTTCAACGTCA
>probe:Drosophila_2:1635851_at:545:197; Interrogation_Position=121; Antisense; AACGTCACCGATCACCGCATTATTC
>probe:Drosophila_2:1635851_at:14:61; Interrogation_Position=13; Antisense; ATGTTCTCGGCGACCAATGGCAAAA
>probe:Drosophila_2:1635851_at:445:15; Interrogation_Position=139; Antisense; ATTATTCCCGTCCACGATGTCGTTT
>probe:Drosophila_2:1635851_at:657:13; Interrogation_Position=155; Antisense; ATGTCGTTTTCCTCGACGATTTCGA
>probe:Drosophila_2:1635851_at:365:687; Interrogation_Position=174; Antisense; TTTCGAACGCAACGTGAAGCCTTTG
>probe:Drosophila_2:1635851_at:414:507; Interrogation_Position=187; Antisense; GTGAAGCCTTTGATTTACCGCCCCG
>probe:Drosophila_2:1635851_at:58:697; Interrogation_Position=200; Antisense; TTTACCGCCCCGTGACGTCAGAGGT
>probe:Drosophila_2:1635851_at:532:627; Interrogation_Position=228; Antisense; TGCCTCTGCCAACGTCGATGAGGAG
>probe:Drosophila_2:1635851_at:29:437; Interrogation_Position=268; Antisense; GAGGAGCAGCGCAGCTTCATTCCAA
>probe:Drosophila_2:1635851_at:577:263; Interrogation_Position=279; Antisense; CAGCTTCATTCCAATCAGCAGGTGA
>probe:Drosophila_2:1635851_at:181:229; Interrogation_Position=28; Antisense; AATGGCAAAATCAAGTTACCTCCGG
>probe:Drosophila_2:1635851_at:266:93; Interrogation_Position=41; Antisense; AGTTACCTCCGGAAGATGCTGTGCT
>probe:Drosophila_2:1635851_at:443:213; Interrogation_Position=53; Antisense; AAGATGCTGTGCTGGTGACGTCACC

Paste this into a BLAST search page for me
TTTCGCGATCTCCACTTCAACGTCAAACGTCACCGATCACCGCATTATTCATGTTCTCGGCGACCAATGGCAAAAATTATTCCCGTCCACGATGTCGTTTATGTCGTTTTCCTCGACGATTTCGATTTCGAACGCAACGTGAAGCCTTTGGTGAAGCCTTTGATTTACCGCCCCGTTTACCGCCCCGTGACGTCAGAGGTTGCCTCTGCCAACGTCGATGAGGAGGAGGAGCAGCGCAGCTTCATTCCAACAGCTTCATTCCAATCAGCAGGTGAAATGGCAAAATCAAGTTACCTCCGGAGTTACCTCCGGAAGATGCTGTGCTAAGATGCTGTGCTGGTGACGTCACC

Full Affymetrix probeset data:

Annotations for 1635851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720