Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635852_at:

>probe:Drosophila_2:1635852_at:496:721; Interrogation_Position=3300; Antisense; TTGCAATTCAAGGTGCCGACCGCTC
>probe:Drosophila_2:1635852_at:700:129; Interrogation_Position=3318; Antisense; ACCGCTCACGATCTTATTTACCTAG
>probe:Drosophila_2:1635852_at:558:697; Interrogation_Position=3334; Antisense; TTTACCTAGACGAAAGTCCCGACTG
>probe:Drosophila_2:1635852_at:276:219; Interrogation_Position=3347; Antisense; AAGTCCCGACTGGTGCCGCAATAGC
>probe:Drosophila_2:1635852_at:126:241; Interrogation_Position=3366; Antisense; AATAGCTATGCGCTGCATTGGCCGG
>probe:Drosophila_2:1635852_at:386:199; Interrogation_Position=3392; Antisense; AACGCACGGACGTGTGTGCCACAAA
>probe:Drosophila_2:1635852_at:105:515; Interrogation_Position=3405; Antisense; GTGTGCCACAAAAACTCGTCGGGAT
>probe:Drosophila_2:1635852_at:97:543; Interrogation_Position=3426; Antisense; GGATTGGAGAGCTGTGCCATCCTCT
>probe:Drosophila_2:1635852_at:328:91; Interrogation_Position=3485; Antisense; AGTTAACGAACGCTGCAATTGCAAA
>probe:Drosophila_2:1635852_at:87:257; Interrogation_Position=3506; Antisense; CAAATTTCACTGGTGTTGCCAGGTT
>probe:Drosophila_2:1635852_at:446:487; Interrogation_Position=3552; Antisense; GTACTCGAGGAGCACACATGTAAAT
>probe:Drosophila_2:1635852_at:573:351; Interrogation_Position=3725; Antisense; GCACTACCAAAATCAATCGGCGGAT
>probe:Drosophila_2:1635852_at:494:711; Interrogation_Position=3788; Antisense; TTAATTGCCATTACCATACACCATC
>probe:Drosophila_2:1635852_at:179:273; Interrogation_Position=3802; Antisense; CATACACCATCATATTGCTTCTTCT

Paste this into a BLAST search page for me
TTGCAATTCAAGGTGCCGACCGCTCACCGCTCACGATCTTATTTACCTAGTTTACCTAGACGAAAGTCCCGACTGAAGTCCCGACTGGTGCCGCAATAGCAATAGCTATGCGCTGCATTGGCCGGAACGCACGGACGTGTGTGCCACAAAGTGTGCCACAAAAACTCGTCGGGATGGATTGGAGAGCTGTGCCATCCTCTAGTTAACGAACGCTGCAATTGCAAACAAATTTCACTGGTGTTGCCAGGTTGTACTCGAGGAGCACACATGTAAATGCACTACCAAAATCAATCGGCGGATTTAATTGCCATTACCATACACCATCCATACACCATCATATTGCTTCTTCT

Full Affymetrix probeset data:

Annotations for 1635852_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime