FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635855_at:

>probe:Drosophila_2:1635855_at:146:303; Interrogation_Position=1018; Antisense; CCGCCAACCTTTGCGATGAGCAGTT
>probe:Drosophila_2:1635855_at:415:57; Interrogation_Position=1033; Antisense; ATGAGCAGTTTGAGGGCTCGCCTCC
>probe:Drosophila_2:1635855_at:93:649; Interrogation_Position=1062; Antisense; TCAGCAGCGCCATCAGAAACATCAG
>probe:Drosophila_2:1635855_at:180:435; Interrogation_Position=1162; Antisense; GAGGTGGCCCACAGCAGTTTCCAGC
>probe:Drosophila_2:1635855_at:598:133; Interrogation_Position=1203; Antisense; ACCCAGTGCGGTGGCATTCGAGCAA
>probe:Drosophila_2:1635855_at:245:11; Interrogation_Position=1218; Antisense; ATTCGAGCAACCTCTGGCCAAGGCG
>probe:Drosophila_2:1635855_at:465:103; Interrogation_Position=1265; Antisense; AGACGCGCGACAATATCCGGCAACG
>probe:Drosophila_2:1635855_at:235:139; Interrogation_Position=1287; Antisense; ACGTGGATCAATCAAGTTTGCCGAC
>probe:Drosophila_2:1635855_at:201:625; Interrogation_Position=1305; Antisense; TGCCGACAAACCCAACTACGATGAA
>probe:Drosophila_2:1635855_at:434:587; Interrogation_Position=755; Antisense; TGGAGAGCGGTTTTGTGCCCAGTCA
>probe:Drosophila_2:1635855_at:80:527; Interrogation_Position=780; Antisense; GGGAATGACTTTCAGGTCACCACCA
>probe:Drosophila_2:1635855_at:473:683; Interrogation_Position=889; Antisense; TATCCCGCCTCGTTCCTAAAGAAAT
>probe:Drosophila_2:1635855_at:496:241; Interrogation_Position=911; Antisense; AATACCGTGAACGAGAGGCCACCAC
>probe:Drosophila_2:1635855_at:519:77; Interrogation_Position=968; Antisense; AGGTCTATCTGATCCGCGAGGGCGA

Paste this into a BLAST search page for me
CCGCCAACCTTTGCGATGAGCAGTTATGAGCAGTTTGAGGGCTCGCCTCCTCAGCAGCGCCATCAGAAACATCAGGAGGTGGCCCACAGCAGTTTCCAGCACCCAGTGCGGTGGCATTCGAGCAAATTCGAGCAACCTCTGGCCAAGGCGAGACGCGCGACAATATCCGGCAACGACGTGGATCAATCAAGTTTGCCGACTGCCGACAAACCCAACTACGATGAATGGAGAGCGGTTTTGTGCCCAGTCAGGGAATGACTTTCAGGTCACCACCATATCCCGCCTCGTTCCTAAAGAAATAATACCGTGAACGAGAGGCCACCACAGGTCTATCTGATCCGCGAGGGCGA

Full Affymetrix probeset data:

Annotations for 1635855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720