FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635856_at:

>probe:Drosophila_2:1635856_at:363:381; Interrogation_Position=128; Antisense; GAACGAGGGATACACGGAGTCTAAA
>probe:Drosophila_2:1635856_at:464:221; Interrogation_Position=156; Antisense; AAGTGTCCAGAAGATCACCCTGATC
>probe:Drosophila_2:1635856_at:268:333; Interrogation_Position=228; Antisense; GCTGGCCAAGCGACGGGATCTGCAC
>probe:Drosophila_2:1635856_at:712:529; Interrogation_Position=242; Antisense; GGGATCTGCACCTGTTGCGATTGGA
>probe:Drosophila_2:1635856_at:571:601; Interrogation_Position=296; Antisense; TGTTCAAACTAGTCACAGCTGCTGA
>probe:Drosophila_2:1635856_at:610:549; Interrogation_Position=384; Antisense; GGAGAAATCCCTTACCATTGGTGCG
>probe:Drosophila_2:1635856_at:80:591; Interrogation_Position=402; Antisense; TGGTGCGCGCATCACAGAGCACGAT
>probe:Drosophila_2:1635856_at:372:641; Interrogation_Position=428; Antisense; TCTCCTCCAGACTCAAGAACATTGT
>probe:Drosophila_2:1635856_at:422:79; Interrogation_Position=476; Antisense; AGGTTCGCATCCTTATCCAGGGCAA
>probe:Drosophila_2:1635856_at:393:415; Interrogation_Position=529; Antisense; GAGCGCATAGTAAAGGCCATCGAAC
>probe:Drosophila_2:1635856_at:691:575; Interrogation_Position=543; Antisense; GGCCATCGAACAGACCATTAAGGAA
>probe:Drosophila_2:1635856_at:684:415; Interrogation_Position=606; Antisense; GAGCGCGTTTATCAAATTCTCGATT
>probe:Drosophila_2:1635856_at:546:11; Interrogation_Position=621; Antisense; ATTCTCGATTATTCCAGTAGCTCCG
>probe:Drosophila_2:1635856_at:433:627; Interrogation_Position=666; Antisense; TGCCACTTCCAATACAATCCAGTCG

Paste this into a BLAST search page for me
GAACGAGGGATACACGGAGTCTAAAAAGTGTCCAGAAGATCACCCTGATCGCTGGCCAAGCGACGGGATCTGCACGGGATCTGCACCTGTTGCGATTGGATGTTCAAACTAGTCACAGCTGCTGAGGAGAAATCCCTTACCATTGGTGCGTGGTGCGCGCATCACAGAGCACGATTCTCCTCCAGACTCAAGAACATTGTAGGTTCGCATCCTTATCCAGGGCAAGAGCGCATAGTAAAGGCCATCGAACGGCCATCGAACAGACCATTAAGGAAGAGCGCGTTTATCAAATTCTCGATTATTCTCGATTATTCCAGTAGCTCCGTGCCACTTCCAATACAATCCAGTCG

Full Affymetrix probeset data:

Annotations for 1635856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720