FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635857_at:

>probe:Drosophila_2:1635857_at:220:229; Interrogation_Position=189; Antisense; AATGAAGTCCTTCTATGCCTCGGTA
>probe:Drosophila_2:1635857_at:445:289; Interrogation_Position=247; Antisense; CGGAACGCGTTTGCAGCCATGTATA
>probe:Drosophila_2:1635857_at:146:479; Interrogation_Position=267; Antisense; GTATAGGCGCCACAAGGCTGACGCA
>probe:Drosophila_2:1635857_at:555:29; Interrogation_Position=305; Antisense; ATAACTACGTTGATGATCCCGTGGA
>probe:Drosophila_2:1635857_at:91:429; Interrogation_Position=331; Antisense; GAGTACGTGCCTATTTATCAAACCG
>probe:Drosophila_2:1635857_at:43:481; Interrogation_Position=355; Antisense; GTATTCGATGACGACCGGGATCCCG
>probe:Drosophila_2:1635857_at:24:27; Interrogation_Position=409; Antisense; ATACCCCTTCAGATACGTTGTCTGG
>probe:Drosophila_2:1635857_at:41:383; Interrogation_Position=433; Antisense; GAACGTTACCACAATTCCAAGCGGG
>probe:Drosophila_2:1635857_at:30:91; Interrogation_Position=458; Antisense; AGTACGCCGATCAGTTCAAGCGGGA
>probe:Drosophila_2:1635857_at:200:323; Interrogation_Position=514; Antisense; GCGCAGGAGGCTTGGCAATTCGTAA
>probe:Drosophila_2:1635857_at:227:209; Interrogation_Position=537; Antisense; AAGAACCATGGCCTATACCACACTT
>probe:Drosophila_2:1635857_at:508:581; Interrogation_Position=562; Antisense; TGGCCGCCGCTGCACACAAGAAAAG
>probe:Drosophila_2:1635857_at:139:401; Interrogation_Position=607; Antisense; GACTTTTGCAAGCTTAACCCTCAAG
>probe:Drosophila_2:1635857_at:579:241; Interrogation_Position=82; Antisense; AATACCCGGCACTTCAATACAACAT

Paste this into a BLAST search page for me
AATGAAGTCCTTCTATGCCTCGGTACGGAACGCGTTTGCAGCCATGTATAGTATAGGCGCCACAAGGCTGACGCAATAACTACGTTGATGATCCCGTGGAGAGTACGTGCCTATTTATCAAACCGGTATTCGATGACGACCGGGATCCCGATACCCCTTCAGATACGTTGTCTGGGAACGTTACCACAATTCCAAGCGGGAGTACGCCGATCAGTTCAAGCGGGAGCGCAGGAGGCTTGGCAATTCGTAAAAGAACCATGGCCTATACCACACTTTGGCCGCCGCTGCACACAAGAAAAGGACTTTTGCAAGCTTAACCCTCAAGAATACCCGGCACTTCAATACAACAT

Full Affymetrix probeset data:

Annotations for 1635857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720