Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635863_at:

>probe:Drosophila_2:1635863_at:374:607; Interrogation_Position=2297; Antisense; TGAGGAGCACCGTTCCCGGCATTGA
>probe:Drosophila_2:1635863_at:512:371; Interrogation_Position=2334; Antisense; GAAGTTGGAACCATCGCCAGTGGAC
>probe:Drosophila_2:1635863_at:469:313; Interrogation_Position=2349; Antisense; GCCAGTGGACCCGTAATCAAGTGTA
>probe:Drosophila_2:1635863_at:677:659; Interrogation_Position=2418; Antisense; TAAGCCGCAGCTTGGTGGGATGACA
>probe:Drosophila_2:1635863_at:594:393; Interrogation_Position=2439; Antisense; GACAAGCTAGCCACAATTAACAGAT
>probe:Drosophila_2:1635863_at:700:565; Interrogation_Position=2508; Antisense; GGCAAACAGCATAGTTCTTCTAGAC
>probe:Drosophila_2:1635863_at:518:333; Interrogation_Position=2553; Antisense; GCTGACAAGATTTTACCAACGACGG
>probe:Drosophila_2:1635863_at:241:255; Interrogation_Position=2602; Antisense; CAACTTCACATCACAGAATCCTGGC
>probe:Drosophila_2:1635863_at:22:233; Interrogation_Position=2618; Antisense; AATCCTGGCAACATCAAGACCGGCA
>probe:Drosophila_2:1635863_at:571:131; Interrogation_Position=2636; Antisense; ACCGGCAGACCGAAGTCAGCAGCAG
>probe:Drosophila_2:1635863_at:264:527; Interrogation_Position=2689; Antisense; GGGACAGTCAGCGTGGGACATTATA
>probe:Drosophila_2:1635863_at:627:15; Interrogation_Position=2708; Antisense; ATTATAGACACTGATGCGCACTGGA
>probe:Drosophila_2:1635863_at:517:157; Interrogation_Position=2743; Antisense; ACAAACAACTAGCATTCCTGCACCG
>probe:Drosophila_2:1635863_at:82:319; Interrogation_Position=2767; Antisense; GCCGTCTTCGCAGCAGAATTTCAAT

Paste this into a BLAST search page for me
TGAGGAGCACCGTTCCCGGCATTGAGAAGTTGGAACCATCGCCAGTGGACGCCAGTGGACCCGTAATCAAGTGTATAAGCCGCAGCTTGGTGGGATGACAGACAAGCTAGCCACAATTAACAGATGGCAAACAGCATAGTTCTTCTAGACGCTGACAAGATTTTACCAACGACGGCAACTTCACATCACAGAATCCTGGCAATCCTGGCAACATCAAGACCGGCAACCGGCAGACCGAAGTCAGCAGCAGGGGACAGTCAGCGTGGGACATTATAATTATAGACACTGATGCGCACTGGAACAAACAACTAGCATTCCTGCACCGGCCGTCTTCGCAGCAGAATTTCAAT

Full Affymetrix probeset data:

Annotations for 1635863_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime