FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635868_at:

>probe:Drosophila_2:1635868_at:168:549; Interrogation_Position=1001; Antisense; GGAGATTACTATGTACCCGTCCGTA
>probe:Drosophila_2:1635868_at:313:327; Interrogation_Position=1026; Antisense; GCGATGCTCCCTACGGAATGGGCAA
>probe:Drosophila_2:1635868_at:138:595; Interrogation_Position=1044; Antisense; TGGGCAACTAAGTCCAGTCTATAAT
>probe:Drosophila_2:1635868_at:609:577; Interrogation_Position=504; Antisense; TGGCTACCCTGATCAACTTTATGCG
>probe:Drosophila_2:1635868_at:286:705; Interrogation_Position=522; Antisense; TTATGCGCAGCAATCACGGCCTGAA
>probe:Drosophila_2:1635868_at:461:379; Interrogation_Position=544; Antisense; GAACCTGGACAACACCATGGTGATT
>probe:Drosophila_2:1635868_at:348:61; Interrogation_Position=588; Antisense; ATGTCTCGGGCTATGCTGGCAAGAA
>probe:Drosophila_2:1635868_at:711:613; Interrogation_Position=615; Antisense; TGAAGAACGGCCAGCTGCACACCAT
>probe:Drosophila_2:1635868_at:130:133; Interrogation_Position=704; Antisense; ACCGATGCTTACTACGTGGAGTCCA
>probe:Drosophila_2:1635868_at:286:263; Interrogation_Position=806; Antisense; CAGCCCGGATGTGGTGTTGATCTCA
>probe:Drosophila_2:1635868_at:434:85; Interrogation_Position=856; Antisense; AGTGATCTACTACGCCGAGTCCGTG
>probe:Drosophila_2:1635868_at:350:429; Interrogation_Position=872; Antisense; GAGTCCGTGACCGAGAACAACTTCC
>probe:Drosophila_2:1635868_at:609:223; Interrogation_Position=935; Antisense; AAGGAGTGCGGTAGCTCCTACAGCT
>probe:Drosophila_2:1635868_at:537:49; Interrogation_Position=984; Antisense; ATGCCTACATGGTCGCTGGAGATTA

Paste this into a BLAST search page for me
GGAGATTACTATGTACCCGTCCGTAGCGATGCTCCCTACGGAATGGGCAATGGGCAACTAAGTCCAGTCTATAATTGGCTACCCTGATCAACTTTATGCGTTATGCGCAGCAATCACGGCCTGAAGAACCTGGACAACACCATGGTGATTATGTCTCGGGCTATGCTGGCAAGAATGAAGAACGGCCAGCTGCACACCATACCGATGCTTACTACGTGGAGTCCACAGCCCGGATGTGGTGTTGATCTCAAGTGATCTACTACGCCGAGTCCGTGGAGTCCGTGACCGAGAACAACTTCCAAGGAGTGCGGTAGCTCCTACAGCTATGCCTACATGGTCGCTGGAGATTA

Full Affymetrix probeset data:

Annotations for 1635868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720