FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635870_at:

>probe:Drosophila_2:1635870_at:225:133; Interrogation_Position=1491; Antisense; ACCCTGTTCGTGGTCTACGAGTACA
>probe:Drosophila_2:1635870_at:450:293; Interrogation_Position=1508; Antisense; CGAGTACACCAAGCGAGCGTTGAGC
>probe:Drosophila_2:1635870_at:657:409; Interrogation_Position=1543; Antisense; GACGACGGCATCAACCATACAATGG
>probe:Drosophila_2:1635870_at:507:227; Interrogation_Position=1563; Antisense; AATGGATCGCGACGAACGGTCCGCT
>probe:Drosophila_2:1635870_at:562:449; Interrogation_Position=1604; Antisense; GATCCGGGAGCAAGACGCTGTGCTA
>probe:Drosophila_2:1635870_at:4:131; Interrogation_Position=1618; Antisense; ACGCTGTGCTAGTAGTTGTCGGCCG
>probe:Drosophila_2:1635870_at:76:321; Interrogation_Position=1639; Antisense; GCCGCGGGCGGTCATTATTAAATAT
>probe:Drosophila_2:1635870_at:345:677; Interrogation_Position=1698; Antisense; TAGATCGTAGTGTTGTGCCTGTACA
>probe:Drosophila_2:1635870_at:71:691; Interrogation_Position=1761; Antisense; TATTGCCGTTTTTATTTCCTGCTAA
>probe:Drosophila_2:1635870_at:286:363; Interrogation_Position=1792; Antisense; GCAATTTGGCTAAGGCGGCGTTTCA
>probe:Drosophila_2:1635870_at:724:327; Interrogation_Position=1809; Antisense; GCGTTTCAGAAAGTCCTGGCGGTCA
>probe:Drosophila_2:1635870_at:96:583; Interrogation_Position=1825; Antisense; TGGCGGTCAGCTGAGTTCTCCAGTT
>probe:Drosophila_2:1635870_at:445:299; Interrogation_Position=1852; Antisense; CGCCACTCGTGCCAATAGATCTGTG
>probe:Drosophila_2:1635870_at:569:653; Interrogation_Position=1917; Antisense; TAATACAACCCGCAGTCTAAGAAGA

Paste this into a BLAST search page for me
ACCCTGTTCGTGGTCTACGAGTACACGAGTACACCAAGCGAGCGTTGAGCGACGACGGCATCAACCATACAATGGAATGGATCGCGACGAACGGTCCGCTGATCCGGGAGCAAGACGCTGTGCTAACGCTGTGCTAGTAGTTGTCGGCCGGCCGCGGGCGGTCATTATTAAATATTAGATCGTAGTGTTGTGCCTGTACATATTGCCGTTTTTATTTCCTGCTAAGCAATTTGGCTAAGGCGGCGTTTCAGCGTTTCAGAAAGTCCTGGCGGTCATGGCGGTCAGCTGAGTTCTCCAGTTCGCCACTCGTGCCAATAGATCTGTGTAATACAACCCGCAGTCTAAGAAGA

Full Affymetrix probeset data:

Annotations for 1635870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720