FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635871_at:

>probe:Drosophila_2:1635871_at:631:577; Interrogation_Position=2507; Antisense; GGCCGATCCGGCACAGTATACAAAT
>probe:Drosophila_2:1635871_at:587:91; Interrogation_Position=2521; Antisense; AGTATACAAATCTCTTCCCTGGCCT
>probe:Drosophila_2:1635871_at:457:635; Interrogation_Position=2611; Antisense; TCGCTGCGAATCTACCACTGAATAG
>probe:Drosophila_2:1635871_at:195:383; Interrogation_Position=2637; Antisense; GAACGTCATCCTCTGCAAGAACTAT
>probe:Drosophila_2:1635871_at:667:251; Interrogation_Position=2652; Antisense; CAAGAACTATTTGCCGCCGAGCAGG
>probe:Drosophila_2:1635871_at:724:97; Interrogation_Position=2703; Antisense; AAGGTGAAGCCAGCTTACGTTCCCG
>probe:Drosophila_2:1635871_at:533:715; Interrogation_Position=2722; Antisense; TTCCCGCTCAAGCTGTTGTTTCTAG
>probe:Drosophila_2:1635871_at:685:723; Interrogation_Position=2737; Antisense; TTGTTTCTAGCAGCCAGGTGGCCGA
>probe:Drosophila_2:1635871_at:68:297; Interrogation_Position=2783; Antisense; CGACGACGACCTGGACTTGGAAATA
>probe:Drosophila_2:1635871_at:235:399; Interrogation_Position=2840; Antisense; GACAGATGTGAACCTCGATGACGAT
>probe:Drosophila_2:1635871_at:199:433; Interrogation_Position=2856; Antisense; GATGACGATTTTCTAAGCGACGATT
>probe:Drosophila_2:1635871_at:13:433; Interrogation_Position=2940; Antisense; GAGTCCCACATTTCGTGCATTTCGA
>probe:Drosophila_2:1635871_at:377:617; Interrogation_Position=2955; Antisense; TGCATTTCGAGCCACAGAATTCCGC
>probe:Drosophila_2:1635871_at:165:11; Interrogation_Position=2973; Antisense; ATTCCGCGCATGCATTCACATTTGA

Paste this into a BLAST search page for me
GGCCGATCCGGCACAGTATACAAATAGTATACAAATCTCTTCCCTGGCCTTCGCTGCGAATCTACCACTGAATAGGAACGTCATCCTCTGCAAGAACTATCAAGAACTATTTGCCGCCGAGCAGGAAGGTGAAGCCAGCTTACGTTCCCGTTCCCGCTCAAGCTGTTGTTTCTAGTTGTTTCTAGCAGCCAGGTGGCCGACGACGACGACCTGGACTTGGAAATAGACAGATGTGAACCTCGATGACGATGATGACGATTTTCTAAGCGACGATTGAGTCCCACATTTCGTGCATTTCGATGCATTTCGAGCCACAGAATTCCGCATTCCGCGCATGCATTCACATTTGA

Full Affymetrix probeset data:

Annotations for 1635871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720