FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635872_at:

>probe:Drosophila_2:1635872_at:66:259; Interrogation_Position=339; Antisense; CACATCGGCATGGTGTACTCGGGAA
>probe:Drosophila_2:1635872_at:82:623; Interrogation_Position=382; Antisense; TGCTGGTCAAGCAGGCCCGCAAGAT
>probe:Drosophila_2:1635872_at:43:1; Interrogation_Position=412; Antisense; AGACGTACTACCTGACCTACAAGGA
>probe:Drosophila_2:1635872_at:503:225; Interrogation_Position=432; Antisense; AAGGAGCCGATTCCAGTGTCACAGC
>probe:Drosophila_2:1635872_at:135:77; Interrogation_Position=484; Antisense; AGGAGTACACTCAGTCCGGTGGCGT
>probe:Drosophila_2:1635872_at:164:137; Interrogation_Position=530; Antisense; ACTGATCTGCGGCTGGGACAATGAT
>probe:Drosophila_2:1635872_at:442:231; Interrogation_Position=549; Antisense; AATGATCGTCCGTATCTCTACCAAT
>probe:Drosophila_2:1635872_at:122:511; Interrogation_Position=630; Antisense; GTGAACGGCAAAACTTTCCTGGAGA
>probe:Drosophila_2:1635872_at:227:695; Interrogation_Position=644; Antisense; TTTCCTGGAGAAGCGCTACAGCGAA
>probe:Drosophila_2:1635872_at:599:587; Interrogation_Position=673; Antisense; TGGAGCTGGACGACGCTGTTCACAC
>probe:Drosophila_2:1635872_at:258:133; Interrogation_Position=696; Antisense; ACCGCCATCCTTACGCTGAAAGAAG
>probe:Drosophila_2:1635872_at:101:327; Interrogation_Position=766; Antisense; GCGATCAGAACGGATTCCAGCGTCT
>probe:Drosophila_2:1635872_at:610:33; Interrogation_Position=804; Antisense; ATCAAGGACTACTTGGCCAGCATCC
>probe:Drosophila_2:1635872_at:696:661; Interrogation_Position=837; Antisense; TAAACGCCCCGCTAAGATTACCACA

Paste this into a BLAST search page for me
CACATCGGCATGGTGTACTCGGGAATGCTGGTCAAGCAGGCCCGCAAGATAGACGTACTACCTGACCTACAAGGAAAGGAGCCGATTCCAGTGTCACAGCAGGAGTACACTCAGTCCGGTGGCGTACTGATCTGCGGCTGGGACAATGATAATGATCGTCCGTATCTCTACCAATGTGAACGGCAAAACTTTCCTGGAGATTTCCTGGAGAAGCGCTACAGCGAATGGAGCTGGACGACGCTGTTCACACACCGCCATCCTTACGCTGAAAGAAGGCGATCAGAACGGATTCCAGCGTCTATCAAGGACTACTTGGCCAGCATCCTAAACGCCCCGCTAAGATTACCACA

Full Affymetrix probeset data:

Annotations for 1635872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720