FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635873_at:

>probe:Drosophila_2:1635873_at:461:335; Interrogation_Position=356; Antisense; GCTCCATTGTAGCTTACTGTCATGC
>probe:Drosophila_2:1635873_at:479:723; Interrogation_Position=362; Antisense; TTGTAGCTTACTGTCATGCGCTCAC
>probe:Drosophila_2:1635873_at:304:647; Interrogation_Position=375; Antisense; TCATGCGCTCACCTTTCTGATTTAC
>probe:Drosophila_2:1635873_at:279:461; Interrogation_Position=393; Antisense; GATTTACTTTACCATAACTGCGATT
>probe:Drosophila_2:1635873_at:76:195; Interrogation_Position=408; Antisense; AACTGCGATTTTGGTGATCGTCCTT
>probe:Drosophila_2:1635873_at:46:17; Interrogation_Position=415; Antisense; ATTTTGGTGATCGTCCTTGTGCTGA
>probe:Drosophila_2:1635873_at:89:513; Interrogation_Position=421; Antisense; GTGATCGTCCTTGTGCTGATTGGAT
>probe:Drosophila_2:1635873_at:679:637; Interrogation_Position=425; Antisense; TCGTCCTTGTGCTGATTGGATCGTT
>probe:Drosophila_2:1635873_at:61:467; Interrogation_Position=438; Antisense; GATTGGATCGTTTATTCCCTGCGAC
>probe:Drosophila_2:1635873_at:181:545; Interrogation_Position=442; Antisense; GGATCGTTTATTCCCTGCGACCTAA
>probe:Drosophila_2:1635873_at:8:303; Interrogation_Position=454; Antisense; CCCTGCGACCTAACTGCTAATGTAG
>probe:Drosophila_2:1635873_at:351:339; Interrogation_Position=469; Antisense; GCTAATGTAGCTTCCTTGTTCATCT
>probe:Drosophila_2:1635873_at:289:487; Interrogation_Position=475; Antisense; GTAGCTTCCTTGTTCATCTTTATCA
>probe:Drosophila_2:1635873_at:133:275; Interrogation_Position=483; Antisense; CTTGTTCATCTTTATCATGTACCAT

Paste this into a BLAST search page for me
GCTCCATTGTAGCTTACTGTCATGCTTGTAGCTTACTGTCATGCGCTCACTCATGCGCTCACCTTTCTGATTTACGATTTACTTTACCATAACTGCGATTAACTGCGATTTTGGTGATCGTCCTTATTTTGGTGATCGTCCTTGTGCTGAGTGATCGTCCTTGTGCTGATTGGATTCGTCCTTGTGCTGATTGGATCGTTGATTGGATCGTTTATTCCCTGCGACGGATCGTTTATTCCCTGCGACCTAACCCTGCGACCTAACTGCTAATGTAGGCTAATGTAGCTTCCTTGTTCATCTGTAGCTTCCTTGTTCATCTTTATCACTTGTTCATCTTTATCATGTACCAT

Full Affymetrix probeset data:

Annotations for 1635873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720