FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635874_at:

>probe:Drosophila_2:1635874_at:310:165; Interrogation_Position=1787; Antisense; AAATCGACAGCCACTTCAATTGCAT
>probe:Drosophila_2:1635874_at:594:271; Interrogation_Position=1812; Antisense; CATAGCTACGCTGAGTGACCACGGG
>probe:Drosophila_2:1635874_at:138:183; Interrogation_Position=1865; Antisense; AAAACGATGCCAGATTGCTCCTCGA
>probe:Drosophila_2:1635874_at:134:621; Interrogation_Position=1880; Antisense; TGCTCCTCGATGTGAGTAAGCCCAC
>probe:Drosophila_2:1635874_at:33:297; Interrogation_Position=1932; Antisense; CGCTCCCATGGTTCACAATATTGTG
>probe:Drosophila_2:1635874_at:141:21; Interrogation_Position=1949; Antisense; ATATTGTGAATGTCTCCGGAGCGGG
>probe:Drosophila_2:1635874_at:443:573; Interrogation_Position=1972; Antisense; GGCGATAGTTTCTGCGCGGGCTTCA
>probe:Drosophila_2:1635874_at:368:83; Interrogation_Position=2013; Antisense; AGGGCGATCTCTGGACGAGTGCATC
>probe:Drosophila_2:1635874_at:385:275; Interrogation_Position=2046; Antisense; CTTTGTGGCCGCTGAAAGGGCACTG
>probe:Drosophila_2:1635874_at:607:169; Interrogation_Position=2060; Antisense; AAAGGGCACTGCAGTCTGAGTCCGC
>probe:Drosophila_2:1635874_at:120:633; Interrogation_Position=2088; Antisense; TCCCGCAACGTACTTCTCAAATCAA
>probe:Drosophila_2:1635874_at:334:99; Interrogation_Position=2123; Antisense; AGAGTCGCTACAAGCATACTGCCCG
>probe:Drosophila_2:1635874_at:105:29; Interrogation_Position=2138; Antisense; ATACTGCCCGGATCATTCAACAGCA
>probe:Drosophila_2:1635874_at:207:371; Interrogation_Position=2199; Antisense; GAAGGCATTTACTCAGGACGTTTTA

Paste this into a BLAST search page for me
AAATCGACAGCCACTTCAATTGCATCATAGCTACGCTGAGTGACCACGGGAAAACGATGCCAGATTGCTCCTCGATGCTCCTCGATGTGAGTAAGCCCACCGCTCCCATGGTTCACAATATTGTGATATTGTGAATGTCTCCGGAGCGGGGGCGATAGTTTCTGCGCGGGCTTCAAGGGCGATCTCTGGACGAGTGCATCCTTTGTGGCCGCTGAAAGGGCACTGAAAGGGCACTGCAGTCTGAGTCCGCTCCCGCAACGTACTTCTCAAATCAAAGAGTCGCTACAAGCATACTGCCCGATACTGCCCGGATCATTCAACAGCAGAAGGCATTTACTCAGGACGTTTTA

Full Affymetrix probeset data:

Annotations for 1635874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720