FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635875_at:

>probe:Drosophila_2:1635875_at:704:511; Interrogation_Position=2009; Antisense; GTGAGCCCCATTTTGGCGGTTATTA
>probe:Drosophila_2:1635875_at:480:435; Interrogation_Position=2069; Antisense; GAGGATCTTAGTTCCATTACGAAAG
>probe:Drosophila_2:1635875_at:539:707; Interrogation_Position=2085; Antisense; TTACGAAAGTTCCAGCGTCTGCACT
>probe:Drosophila_2:1635875_at:567:287; Interrogation_Position=2111; Antisense; CGGCGTCGTCTGAGTTTTTGGCAAA
>probe:Drosophila_2:1635875_at:233:565; Interrogation_Position=2130; Antisense; GGCAAAACCACGGATTGATCTCGGA
>probe:Drosophila_2:1635875_at:84:599; Interrogation_Position=2145; Antisense; TGATCTCGGAAACGACACCCGGAAT
>probe:Drosophila_2:1635875_at:361:133; Interrogation_Position=2161; Antisense; ACCCGGAATATTCACGCTGCTGGAA
>probe:Drosophila_2:1635875_at:374:19; Interrogation_Position=2244; Antisense; ATTTGGAATCCGCAATGGCTTCTGC
>probe:Drosophila_2:1635875_at:91:69; Interrogation_Position=2258; Antisense; ATGGCTTCTGCCAGCGATCAAAGGG
>probe:Drosophila_2:1635875_at:293:369; Interrogation_Position=2319; Antisense; GAATGCTCACGAATCTTGACTCCAT
>probe:Drosophila_2:1635875_at:460:725; Interrogation_Position=2334; Antisense; TTGACTCCATGCCAATTGACCGAAT
>probe:Drosophila_2:1635875_at:333:725; Interrogation_Position=2349; Antisense; TTGACCGAATCCACCAGATGCTGAA
>probe:Drosophila_2:1635875_at:407:97; Interrogation_Position=2364; Antisense; AGATGCTGAAGCTGTTCGCCTCCCA
>probe:Drosophila_2:1635875_at:382:547; Interrogation_Position=2413; Antisense; GGATGAGCTGAAACACTTTCTCCAG

Paste this into a BLAST search page for me
GTGAGCCCCATTTTGGCGGTTATTAGAGGATCTTAGTTCCATTACGAAAGTTACGAAAGTTCCAGCGTCTGCACTCGGCGTCGTCTGAGTTTTTGGCAAAGGCAAAACCACGGATTGATCTCGGATGATCTCGGAAACGACACCCGGAATACCCGGAATATTCACGCTGCTGGAAATTTGGAATCCGCAATGGCTTCTGCATGGCTTCTGCCAGCGATCAAAGGGGAATGCTCACGAATCTTGACTCCATTTGACTCCATGCCAATTGACCGAATTTGACCGAATCCACCAGATGCTGAAAGATGCTGAAGCTGTTCGCCTCCCAGGATGAGCTGAAACACTTTCTCCAG

Full Affymetrix probeset data:

Annotations for 1635875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720