Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635878_s_at:

>probe:Drosophila_2:1635878_s_at:610:433; Interrogation_Position=266; Antisense; GAGTGGGTTCCACTTCCAGGAGCTC
>probe:Drosophila_2:1635878_s_at:335:455; Interrogation_Position=354; Antisense; GATCAACGATGTGGCCATCATCAAG
>probe:Drosophila_2:1635878_s_at:682:99; Interrogation_Position=398; Antisense; AGACCTCTAAGATCCGGGCCATCGA
>probe:Drosophila_2:1635878_s_at:488:617; Interrogation_Position=433; Antisense; TCCGAGGCCGTTTCCGGAACCAATG
>probe:Drosophila_2:1635878_s_at:141:605; Interrogation_Position=531; Antisense; TGATCTGCTGCACTACAAGGACTGT
>probe:Drosophila_2:1635878_s_at:284:665; Interrogation_Position=544; Antisense; TACAAGGACTGTGCCGCCGACACGT
>probe:Drosophila_2:1635878_s_at:310:491; Interrogation_Position=567; Antisense; GTACAACTACGGCAGCGACTCGATT
>probe:Drosophila_2:1635878_s_at:323:405; Interrogation_Position=583; Antisense; GACTCGATTCTGGAGACCATGGTCT
>probe:Drosophila_2:1635878_s_at:391:129; Interrogation_Position=598; Antisense; ACCATGGTCTGTGCCACCGGCGAGA
>probe:Drosophila_2:1635878_s_at:405:517; Interrogation_Position=650; Antisense; GTGGTCCTTTGGTCGCGGACAACAA
>probe:Drosophila_2:1635878_s_at:425:119; Interrogation_Position=700; Antisense; AGCGGATGTGCCTGGACCGGCTACC
>probe:Drosophila_2:1635878_s_at:379:645; Interrogation_Position=731; Antisense; TCTATGCCGATGTCGCCAGCCTGAG
>probe:Drosophila_2:1635878_s_at:459:315; Interrogation_Position=749; Antisense; GCCTGAGGAGCTGGATCGTTGACAC
>probe:Drosophila_2:1635878_s_at:331:467; Interrogation_Position=766; Antisense; GTTGACACCACTGACTCGTTGTAAA

Paste this into a BLAST search page for me
GAGTGGGTTCCACTTCCAGGAGCTCGATCAACGATGTGGCCATCATCAAGAGACCTCTAAGATCCGGGCCATCGATCCGAGGCCGTTTCCGGAACCAATGTGATCTGCTGCACTACAAGGACTGTTACAAGGACTGTGCCGCCGACACGTGTACAACTACGGCAGCGACTCGATTGACTCGATTCTGGAGACCATGGTCTACCATGGTCTGTGCCACCGGCGAGAGTGGTCCTTTGGTCGCGGACAACAAAGCGGATGTGCCTGGACCGGCTACCTCTATGCCGATGTCGCCAGCCTGAGGCCTGAGGAGCTGGATCGTTGACACGTTGACACCACTGACTCGTTGTAAA

Full Affymetrix probeset data:

Annotations for 1635878_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime