FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635880_at:

>probe:Drosophila_2:1635880_at:388:223; Interrogation_Position=217; Antisense; AAGGTCCATCTGATGGCCTGCCAAA
>probe:Drosophila_2:1635880_at:598:171; Interrogation_Position=239; Antisense; AAAGACGCTTGGCACGCATGATGAA
>probe:Drosophila_2:1635880_at:179:517; Interrogation_Position=277; Antisense; GTGTCCCAGCATCAGTGCAACATTT
>probe:Drosophila_2:1635880_at:289:107; Interrogation_Position=305; Antisense; AGAAAATCTTCTCCTCGGTGGATGC
>probe:Drosophila_2:1635880_at:476:379; Interrogation_Position=356; Antisense; GAAGCCCATCAATGAATCGCACCTG
>probe:Drosophila_2:1635880_at:180:347; Interrogation_Position=382; Antisense; GCATCCTGCCATGTCAAGTTCGGGA
>probe:Drosophila_2:1635880_at:660:527; Interrogation_Position=403; Antisense; GGGACGGATCTGGAGTATCGCACCC
>probe:Drosophila_2:1635880_at:595:483; Interrogation_Position=417; Antisense; GTATCGCACCCATTTGGAGAGCCAT
>probe:Drosophila_2:1635880_at:551:425; Interrogation_Position=433; Antisense; GAGAGCCATCTGATACCGTGCGAGT
>probe:Drosophila_2:1635880_at:609:247; Interrogation_Position=505; Antisense; AATTGCGTCTTTTGTCGCACGGAGT
>probe:Drosophila_2:1635880_at:326:259; Interrogation_Position=522; Antisense; CACGGAGTTCAAGGCCTGCTTTAAG
>probe:Drosophila_2:1635880_at:198:221; Interrogation_Position=554; Antisense; AAGTGACCCGTCGATACGCGTGCGA
>probe:Drosophila_2:1635880_at:15:243; Interrogation_Position=677; Antisense; AATATGAGGGTTTCCTTCACCGTCA
>probe:Drosophila_2:1635880_at:439:389; Interrogation_Position=705; Antisense; GAAAACTTGCCAGATGCCGGATAAA

Paste this into a BLAST search page for me
AAGGTCCATCTGATGGCCTGCCAAAAAAGACGCTTGGCACGCATGATGAAGTGTCCCAGCATCAGTGCAACATTTAGAAAATCTTCTCCTCGGTGGATGCGAAGCCCATCAATGAATCGCACCTGGCATCCTGCCATGTCAAGTTCGGGAGGGACGGATCTGGAGTATCGCACCCGTATCGCACCCATTTGGAGAGCCATGAGAGCCATCTGATACCGTGCGAGTAATTGCGTCTTTTGTCGCACGGAGTCACGGAGTTCAAGGCCTGCTTTAAGAAGTGACCCGTCGATACGCGTGCGAAATATGAGGGTTTCCTTCACCGTCAGAAAACTTGCCAGATGCCGGATAAA

Full Affymetrix probeset data:

Annotations for 1635880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720