FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635881_at:

>probe:Drosophila_2:1635881_at:719:65; Interrogation_Position=1003; Antisense; ATGGACGAGTCGGACACTCCAAGCC
>probe:Drosophila_2:1635881_at:448:359; Interrogation_Position=1029; Antisense; GCAACTGCAGCATACGCCTACGTCG
>probe:Drosophila_2:1635881_at:55:277; Interrogation_Position=1046; Antisense; CTACGTCGCGGGTTTTCTGCTGCGG
>probe:Drosophila_2:1635881_at:599:525; Interrogation_Position=1070; Antisense; GGGAGGTGCCTTTACGTGGATCCAA
>probe:Drosophila_2:1635881_at:439:45; Interrogation_Position=1104; Antisense; ATCCGGTCCTGGACAAGCGGTGCAG
>probe:Drosophila_2:1635881_at:321:121; Interrogation_Position=1119; Antisense; AGCGGTGCAGGTCATCACCATGCAG
>probe:Drosophila_2:1635881_at:111:375; Interrogation_Position=1179; Antisense; GAAGATTTCCCAAGTGCAACTTTAG
>probe:Drosophila_2:1635881_at:571:561; Interrogation_Position=1210; Antisense; GGAAGACGAATCTCACGCGGATTAA
>probe:Drosophila_2:1635881_at:416:577; Interrogation_Position=1241; Antisense; GGCGCTGGAAGCTATTTGTTGATAT
>probe:Drosophila_2:1635881_at:135:547; Interrogation_Position=903; Antisense; GGATGCGGTGCGTCCCAACCATTTG
>probe:Drosophila_2:1635881_at:611:199; Interrogation_Position=919; Antisense; AACCATTTGCTCTTTAACCACGCCT
>probe:Drosophila_2:1635881_at:188:707; Interrogation_Position=932; Antisense; TTAACCACGCCTATACGGACAACAA
>probe:Drosophila_2:1635881_at:341:381; Interrogation_Position=960; Antisense; GAACGCGAACAGCTACTCTATAGGC
>probe:Drosophila_2:1635881_at:730:145; Interrogation_Position=974; Antisense; ACTCTATAGGCGACCAGCTGGAGCA

Paste this into a BLAST search page for me
ATGGACGAGTCGGACACTCCAAGCCGCAACTGCAGCATACGCCTACGTCGCTACGTCGCGGGTTTTCTGCTGCGGGGGAGGTGCCTTTACGTGGATCCAAATCCGGTCCTGGACAAGCGGTGCAGAGCGGTGCAGGTCATCACCATGCAGGAAGATTTCCCAAGTGCAACTTTAGGGAAGACGAATCTCACGCGGATTAAGGCGCTGGAAGCTATTTGTTGATATGGATGCGGTGCGTCCCAACCATTTGAACCATTTGCTCTTTAACCACGCCTTTAACCACGCCTATACGGACAACAAGAACGCGAACAGCTACTCTATAGGCACTCTATAGGCGACCAGCTGGAGCA

Full Affymetrix probeset data:

Annotations for 1635881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720