FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635887_at:

>probe:Drosophila_2:1635887_at:498:181; Interrogation_Position=105; Antisense; AAAACTGAAGATGCTCCGCTGTTCC
>probe:Drosophila_2:1635887_at:395:729; Interrogation_Position=177; Antisense; TTGGAGCTACTGGAGCGGATTCCCA
>probe:Drosophila_2:1635887_at:136:293; Interrogation_Position=227; Antisense; CGATGTGCTGACAGCCGTCAAGGAA
>probe:Drosophila_2:1635887_at:490:563; Interrogation_Position=248; Antisense; GGAAGTGGATAACCTCTGCGACTAT
>probe:Drosophila_2:1635887_at:69:405; Interrogation_Position=267; Antisense; GACTATCCGCGCTGCAAGACCAAAA
>probe:Drosophila_2:1635887_at:175:183; Interrogation_Position=288; Antisense; AAAACCAGCCTGATGGGCCAAGACT
>probe:Drosophila_2:1635887_at:707:579; Interrogation_Position=303; Antisense; GGCCAAGACTGCCAGCATTGCAAGA
>probe:Drosophila_2:1635887_at:389:343; Interrogation_Position=337; Antisense; GCTTCAAGCACGGACTGCCAGAGGT
>probe:Drosophila_2:1635887_at:52:325; Interrogation_Position=395; Antisense; GCGCAAGAAGTTTCTGCACCCGAAG
>probe:Drosophila_2:1635887_at:346:379; Interrogation_Position=416; Antisense; GAAGCCGGCGAAAACCATCAGGCAG
>probe:Drosophila_2:1635887_at:669:575; Interrogation_Position=502; Antisense; GGCGCACTCAAAAAGCCACCGGAGG
>probe:Drosophila_2:1635887_at:266:533; Interrogation_Position=611; Antisense; GGTGTTTCAGTACAGCCAAAATTGC
>probe:Drosophila_2:1635887_at:534:567; Interrogation_Position=71; Antisense; GGCAGACGATCCAAACAAGCCCTCT
>probe:Drosophila_2:1635887_at:36:301; Interrogation_Position=90; Antisense; CCCTCTACCTCGTCGAAAACTGAAG

Paste this into a BLAST search page for me
AAAACTGAAGATGCTCCGCTGTTCCTTGGAGCTACTGGAGCGGATTCCCACGATGTGCTGACAGCCGTCAAGGAAGGAAGTGGATAACCTCTGCGACTATGACTATCCGCGCTGCAAGACCAAAAAAAACCAGCCTGATGGGCCAAGACTGGCCAAGACTGCCAGCATTGCAAGAGCTTCAAGCACGGACTGCCAGAGGTGCGCAAGAAGTTTCTGCACCCGAAGGAAGCCGGCGAAAACCATCAGGCAGGGCGCACTCAAAAAGCCACCGGAGGGGTGTTTCAGTACAGCCAAAATTGCGGCAGACGATCCAAACAAGCCCTCTCCCTCTACCTCGTCGAAAACTGAAG

Full Affymetrix probeset data:

Annotations for 1635887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720