FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635890_at:

>probe:Drosophila_2:1635890_at:192:177; Interrogation_Position=1013; Antisense; AAACGGACTCCTCATCTGCAAATAG
>probe:Drosophila_2:1635890_at:527:179; Interrogation_Position=1074; Antisense; AAAAAATGCGGACTCCACGGTCCTG
>probe:Drosophila_2:1635890_at:588:289; Interrogation_Position=1106; Antisense; CGGACATTGTCATCGTGCTGGAAAA
>probe:Drosophila_2:1635890_at:247:127; Interrogation_Position=1132; Antisense; AGCCACACAGTTTGCGAGGAGCCCA
>probe:Drosophila_2:1635890_at:25:463; Interrogation_Position=1211; Antisense; GATTAATGAGCATACCTGGCCAATG
>probe:Drosophila_2:1635890_at:130:581; Interrogation_Position=1228; Antisense; GGCCAATGGTTCTGTCGCATCTGGA
>probe:Drosophila_2:1635890_at:599:717; Interrogation_Position=1290; Antisense; TTCGTGTCGCGATATGATCTCTCGG
>probe:Drosophila_2:1635890_at:527:155; Interrogation_Position=1392; Antisense; ACAGCAGCTCCTCTATGGCAGCAGA
>probe:Drosophila_2:1635890_at:34:61; Interrogation_Position=844; Antisense; ATGTCACGTCGCTACAGGGTTGCGT
>probe:Drosophila_2:1635890_at:433:473; Interrogation_Position=867; Antisense; GTTCAGGGAACTCCTCTGCGGAAAA
>probe:Drosophila_2:1635890_at:60:519; Interrogation_Position=895; Antisense; GTGGGCGCCTATTACAACAGCGGAT
>probe:Drosophila_2:1635890_at:684:457; Interrogation_Position=917; Antisense; GATTTGCGAGGGATCACTCCAGTTT
>probe:Drosophila_2:1635890_at:537:471; Interrogation_Position=967; Antisense; GTTCATTCTGTTCACGTCAGAGCCA
>probe:Drosophila_2:1635890_at:234:313; Interrogation_Position=988; Antisense; GCCAGCCAGCATCCAAATAAGTTCG

Paste this into a BLAST search page for me
AAACGGACTCCTCATCTGCAAATAGAAAAAATGCGGACTCCACGGTCCTGCGGACATTGTCATCGTGCTGGAAAAAGCCACACAGTTTGCGAGGAGCCCAGATTAATGAGCATACCTGGCCAATGGGCCAATGGTTCTGTCGCATCTGGATTCGTGTCGCGATATGATCTCTCGGACAGCAGCTCCTCTATGGCAGCAGAATGTCACGTCGCTACAGGGTTGCGTGTTCAGGGAACTCCTCTGCGGAAAAGTGGGCGCCTATTACAACAGCGGATGATTTGCGAGGGATCACTCCAGTTTGTTCATTCTGTTCACGTCAGAGCCAGCCAGCCAGCATCCAAATAAGTTCG

Full Affymetrix probeset data:

Annotations for 1635890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720