FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635891_at:

>probe:Drosophila_2:1635891_at:115:311; Interrogation_Position=101; Antisense; CCAATCGCCCGACTGCAAGGAAATA
>probe:Drosophila_2:1635891_at:182:337; Interrogation_Position=136; Antisense; GCTCGAAATGCATCCAAAGACTTAA
>probe:Drosophila_2:1635891_at:388:103; Interrogation_Position=153; Antisense; AGACTTAATGATCCCTACAACAAGG
>probe:Drosophila_2:1635891_at:588:563; Interrogation_Position=229; Antisense; GGAAGGACCAGAATCTTTGCGAACT
>probe:Drosophila_2:1635891_at:169:695; Interrogation_Position=244; Antisense; TTTGCGAACTTCAAGCGATAGCTTC
>probe:Drosophila_2:1635891_at:596:457; Interrogation_Position=260; Antisense; GATAGCTTCTCCGAATCGAGCAATG
>probe:Drosophila_2:1635891_at:414:615; Interrogation_Position=283; Antisense; TGAATTGTGTTGTCATCGCCGATGT
>probe:Drosophila_2:1635891_at:378:311; Interrogation_Position=309; Antisense; GCCAAAATGCGCAGAGTGACTCCAA
>probe:Drosophila_2:1635891_at:622:511; Interrogation_Position=324; Antisense; GTGACTCCAAGACCTCCAGGATAAT
>probe:Drosophila_2:1635891_at:38:59; Interrogation_Position=373; Antisense; ATGATATTCACTTTCGGGACTGGAT
>probe:Drosophila_2:1635891_at:642:19; Interrogation_Position=401; Antisense; ATTTGTTTCTCATTTTCTTGAAGCA
>probe:Drosophila_2:1635891_at:180:215; Interrogation_Position=51; Antisense; AAGTTGACTGTCTGCTTCCTGGTGA
>probe:Drosophila_2:1635891_at:238:513; Interrogation_Position=72; Antisense; GTGATCCTGGGCTGTGTGATAGTCC
>probe:Drosophila_2:1635891_at:402:517; Interrogation_Position=85; Antisense; GTGTGATAGTCCATGGCCAATCGCC

Paste this into a BLAST search page for me
CCAATCGCCCGACTGCAAGGAAATAGCTCGAAATGCATCCAAAGACTTAAAGACTTAATGATCCCTACAACAAGGGGAAGGACCAGAATCTTTGCGAACTTTTGCGAACTTCAAGCGATAGCTTCGATAGCTTCTCCGAATCGAGCAATGTGAATTGTGTTGTCATCGCCGATGTGCCAAAATGCGCAGAGTGACTCCAAGTGACTCCAAGACCTCCAGGATAATATGATATTCACTTTCGGGACTGGATATTTGTTTCTCATTTTCTTGAAGCAAAGTTGACTGTCTGCTTCCTGGTGAGTGATCCTGGGCTGTGTGATAGTCCGTGTGATAGTCCATGGCCAATCGCC

Full Affymetrix probeset data:

Annotations for 1635891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720