FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635892_at:

>probe:Drosophila_2:1635892_at:172:209; Interrogation_Position=313; Antisense; AAGCTACTGGTCGTGCAATTCCGGG
>probe:Drosophila_2:1635892_at:48:311; Interrogation_Position=354; Antisense; CCACACCGCGCATTTTCAGAAGGAA
>probe:Drosophila_2:1635892_at:56:193; Interrogation_Position=377; Antisense; AACTAGTGGAGCTCCTCAAGGGCGC
>probe:Drosophila_2:1635892_at:729:321; Interrogation_Position=398; Antisense; GCGCCAGACGCGTAGTCATTCTAAG
>probe:Drosophila_2:1635892_at:340:659; Interrogation_Position=419; Antisense; TAAGCGGCAGTTTCGGCTTCGAGAA
>probe:Drosophila_2:1635892_at:33:497; Interrogation_Position=448; Antisense; GTCATTGAGGAGTCGCCATGGGCAT
>probe:Drosophila_2:1635892_at:645:225; Interrogation_Position=493; Antisense; AAGGAAGCGCATGCTGCCCAGCTGG
>probe:Drosophila_2:1635892_at:14:111; Interrogation_Position=611; Antisense; AGAAGGTGCCCGTCATGCTGTTATT
>probe:Drosophila_2:1635892_at:538:445; Interrogation_Position=667; Antisense; GATGCATCTCTAATCGTCCGGGAAC
>probe:Drosophila_2:1635892_at:192:505; Interrogation_Position=682; Antisense; GTCCGGGAACTGAACGAACTCTGCG
>probe:Drosophila_2:1635892_at:666:383; Interrogation_Position=697; Antisense; GAACTCTGCGAAGACTTCCTTCAGC
>probe:Drosophila_2:1635892_at:537:293; Interrogation_Position=735; Antisense; CGATGGCAGTTTTAAGCTCACCGTG
>probe:Drosophila_2:1635892_at:62:219; Interrogation_Position=763; Antisense; AAGTCCTGGAACCTACTATTCGGCA
>probe:Drosophila_2:1635892_at:481:153; Interrogation_Position=820; Antisense; ACATGTATTTTTCGGTGCTTTCAAA

Paste this into a BLAST search page for me
AAGCTACTGGTCGTGCAATTCCGGGCCACACCGCGCATTTTCAGAAGGAAAACTAGTGGAGCTCCTCAAGGGCGCGCGCCAGACGCGTAGTCATTCTAAGTAAGCGGCAGTTTCGGCTTCGAGAAGTCATTGAGGAGTCGCCATGGGCATAAGGAAGCGCATGCTGCCCAGCTGGAGAAGGTGCCCGTCATGCTGTTATTGATGCATCTCTAATCGTCCGGGAACGTCCGGGAACTGAACGAACTCTGCGGAACTCTGCGAAGACTTCCTTCAGCCGATGGCAGTTTTAAGCTCACCGTGAAGTCCTGGAACCTACTATTCGGCAACATGTATTTTTCGGTGCTTTCAAA

Full Affymetrix probeset data:

Annotations for 1635892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720