Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635893_at:

>probe:Drosophila_2:1635893_at:715:521; Interrogation_Position=2063; Antisense; GTGGCTGCCCATTTCGAAGGACGAT
>probe:Drosophila_2:1635893_at:246:139; Interrogation_Position=2083; Antisense; ACGATAAGGTGTTCCAGTGCCTGAA
>probe:Drosophila_2:1635893_at:523:625; Interrogation_Position=2100; Antisense; TGCCTGAATATATCGCACGATGTGC
>probe:Drosophila_2:1635893_at:384:269; Interrogation_Position=2124; Antisense; CATGTGATTGATTTGCCCGAAGCCG
>probe:Drosophila_2:1635893_at:598:455; Interrogation_Position=2133; Antisense; GATTTGCCCGAAGCCGAAAAGCTGA
>probe:Drosophila_2:1635893_at:610:207; Interrogation_Position=2151; Antisense; AAGCTGAGACTTTGGGACTGCATCT
>probe:Drosophila_2:1635893_at:532:527; Interrogation_Position=2164; Antisense; GGGACTGCATCTACGACAGGGAACT
>probe:Drosophila_2:1635893_at:131:399; Interrogation_Position=2178; Antisense; GACAGGGAACTCCTCTACTGAAGGC
>probe:Drosophila_2:1635893_at:190:347; Interrogation_Position=2235; Antisense; GCATCCATTTACCATATCCATAGCA
>probe:Drosophila_2:1635893_at:215:677; Interrogation_Position=2275; Antisense; TAGATATAGCTCCTTAACTGGCCCC
>probe:Drosophila_2:1635893_at:159:291; Interrogation_Position=2299; Antisense; CGGGATGGCCTTAAACGCACATCAA
>probe:Drosophila_2:1635893_at:43:693; Interrogation_Position=2415; Antisense; TTTGCTTGTAAGTTGGCCATCTGAC
>probe:Drosophila_2:1635893_at:374:139; Interrogation_Position=2452; Antisense; ACGGAATTATTTTTGCATTGCGGCA
>probe:Drosophila_2:1635893_at:485:495; Interrogation_Position=2547; Antisense; GTCTAAGGTACTTTTCTGTCTAGTT

Paste this into a BLAST search page for me
GTGGCTGCCCATTTCGAAGGACGATACGATAAGGTGTTCCAGTGCCTGAATGCCTGAATATATCGCACGATGTGCCATGTGATTGATTTGCCCGAAGCCGGATTTGCCCGAAGCCGAAAAGCTGAAAGCTGAGACTTTGGGACTGCATCTGGGACTGCATCTACGACAGGGAACTGACAGGGAACTCCTCTACTGAAGGCGCATCCATTTACCATATCCATAGCATAGATATAGCTCCTTAACTGGCCCCCGGGATGGCCTTAAACGCACATCAATTTGCTTGTAAGTTGGCCATCTGACACGGAATTATTTTTGCATTGCGGCAGTCTAAGGTACTTTTCTGTCTAGTT

Full Affymetrix probeset data:

Annotations for 1635893_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime