Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635894_at:

>probe:Drosophila_2:1635894_at:585:607; Interrogation_Position=162; Antisense; TGAGGCTCAGGTGCGCGTGTTCTAT
>probe:Drosophila_2:1635894_at:250:79; Interrogation_Position=221; Antisense; AGGGTATTTCACTGTTTGCCTTCCA
>probe:Drosophila_2:1635894_at:528:661; Interrogation_Position=254; Antisense; TAAACGAGGAGTTCGACGGCCTGGA
>probe:Drosophila_2:1635894_at:525:555; Interrogation_Position=319; Antisense; GGACGTTGGACATTCCGAGATCACA
>probe:Drosophila_2:1635894_at:463:421; Interrogation_Position=362; Antisense; GAGATACCCTGTACTTTTGGACCTA
>probe:Drosophila_2:1635894_at:155:555; Interrogation_Position=380; Antisense; GGACCTACGTCATTTACAACGGGCT
>probe:Drosophila_2:1635894_at:524:369; Interrogation_Position=421; Antisense; GAAGGTGCTCATGTGGTCACCAGTT
>probe:Drosophila_2:1635894_at:634:535; Interrogation_Position=435; Antisense; GGTCACCAGTTACGACAATCCACAT
>probe:Drosophila_2:1635894_at:660:529; Interrogation_Position=487; Antisense; GGGATCGTAGCCGAGCTTAAAGCTC
>probe:Drosophila_2:1635894_at:143:167; Interrogation_Position=505; Antisense; AAAGCTCGTCTTGAACCATTGTTTA
>probe:Drosophila_2:1635894_at:314:549; Interrogation_Position=531; Antisense; GGAGCGTACTTTCCATGCTAATCCG
>probe:Drosophila_2:1635894_at:61:339; Interrogation_Position=555; Antisense; GCTCTTTTGGCTCACAGCTAATCTT
>probe:Drosophila_2:1635894_at:600:339; Interrogation_Position=571; Antisense; GCTAATCTTTTTGCTTGCTACACAA
>probe:Drosophila_2:1635894_at:644:469; Interrogation_Position=73; Antisense; GTTCCATTTCGATTCGTGATGCCTA

Paste this into a BLAST search page for me
TGAGGCTCAGGTGCGCGTGTTCTATAGGGTATTTCACTGTTTGCCTTCCATAAACGAGGAGTTCGACGGCCTGGAGGACGTTGGACATTCCGAGATCACAGAGATACCCTGTACTTTTGGACCTAGGACCTACGTCATTTACAACGGGCTGAAGGTGCTCATGTGGTCACCAGTTGGTCACCAGTTACGACAATCCACATGGGATCGTAGCCGAGCTTAAAGCTCAAAGCTCGTCTTGAACCATTGTTTAGGAGCGTACTTTCCATGCTAATCCGGCTCTTTTGGCTCACAGCTAATCTTGCTAATCTTTTTGCTTGCTACACAAGTTCCATTTCGATTCGTGATGCCTA

Full Affymetrix probeset data:

Annotations for 1635894_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime