Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635895_at:

>probe:Drosophila_2:1635895_at:491:377; Interrogation_Position=1022; Antisense; GAAGCGGACTCCCAACTAGAGCATA
>probe:Drosophila_2:1635895_at:439:419; Interrogation_Position=1040; Antisense; GAGCATATTCTCAATCTGGCAACTG
>probe:Drosophila_2:1635895_at:191:557; Interrogation_Position=1081; Antisense; GGACATACCATTCAGGATTTCTTAT
>probe:Drosophila_2:1635895_at:80:115; Interrogation_Position=1111; Antisense; AGCAGCAGATCTAACTCCGGCGGAG
>probe:Drosophila_2:1635895_at:327:429; Interrogation_Position=1135; Antisense; GAGTATCCGGGCAGTCATCGAAGTT
>probe:Drosophila_2:1635895_at:342:423; Interrogation_Position=1212; Antisense; GAGACTTTGTCTCTAAGCGAATCCT
>probe:Drosophila_2:1635895_at:509:367; Interrogation_Position=1230; Antisense; GAATCCTTTTTAGCACGCGGCGGGA
>probe:Drosophila_2:1635895_at:583:13; Interrogation_Position=1266; Antisense; ATTTCTTGCACATGGTGGGCGGACC
>probe:Drosophila_2:1635895_at:681:633; Interrogation_Position=1304; Antisense; TCGCGACTGATAGCAGCTCTTGTTG
>probe:Drosophila_2:1635895_at:277:69; Interrogation_Position=1332; Antisense; ATGGCGTGCGCTTGGAAGACTGCAA
>probe:Drosophila_2:1635895_at:580:391; Interrogation_Position=1378; Antisense; GAAACCCGTTCATCAGCAGGATCTA
>probe:Drosophila_2:1635895_at:707:645; Interrogation_Position=1450; Antisense; TCTTGTTGTTTGTTCTTAGGCCTAA
>probe:Drosophila_2:1635895_at:595:499; Interrogation_Position=902; Antisense; GTCTGCTGTGGTCGGAGCTACAACA
>probe:Drosophila_2:1635895_at:137:679; Interrogation_Position=944; Antisense; TATGGGCCCATTCCTAGTCTTTATA

Paste this into a BLAST search page for me
GAAGCGGACTCCCAACTAGAGCATAGAGCATATTCTCAATCTGGCAACTGGGACATACCATTCAGGATTTCTTATAGCAGCAGATCTAACTCCGGCGGAGGAGTATCCGGGCAGTCATCGAAGTTGAGACTTTGTCTCTAAGCGAATCCTGAATCCTTTTTAGCACGCGGCGGGAATTTCTTGCACATGGTGGGCGGACCTCGCGACTGATAGCAGCTCTTGTTGATGGCGTGCGCTTGGAAGACTGCAAGAAACCCGTTCATCAGCAGGATCTATCTTGTTGTTTGTTCTTAGGCCTAAGTCTGCTGTGGTCGGAGCTACAACATATGGGCCCATTCCTAGTCTTTATA

Full Affymetrix probeset data:

Annotations for 1635895_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime