FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635897_at:

>probe:Drosophila_2:1635897_at:645:605; Interrogation_Position=183; Antisense; TGAGTATTCCAAGCCGGTGATCCTG
>probe:Drosophila_2:1635897_at:487:437; Interrogation_Position=244; Antisense; GAGGACTCCGAGAATTACCCGTATA
>probe:Drosophila_2:1635897_at:489:259; Interrogation_Position=285; Antisense; CACCACGAATATCCTGTACTTTGTC
>probe:Drosophila_2:1635897_at:443:313; Interrogation_Position=347; Antisense; GCCAGCAGCGCGAAAGCTTCTATAA
>probe:Drosophila_2:1635897_at:403:41; Interrogation_Position=385; Antisense; ATCGTCCTCGTGTACAACATGCTGG
>probe:Drosophila_2:1635897_at:630:615; Interrogation_Position=431; Antisense; TGCACGATTGGCTGTACGATCCGTT
>probe:Drosophila_2:1635897_at:485:283; Interrogation_Position=481; Antisense; CTGCGCATCCGTTCCATATTGAAAA
>probe:Drosophila_2:1635897_at:524:559; Interrogation_Position=543; Antisense; GGACAAGCTGATGCGACGACCACTG
>probe:Drosophila_2:1635897_at:270:5; Interrogation_Position=583; Antisense; ATTGCCCACCAGTTAAACGTCGAGG
>probe:Drosophila_2:1635897_at:444:427; Interrogation_Position=607; Antisense; GAGATGCTCGTCAATTGCCTGGATC
>probe:Drosophila_2:1635897_at:617:315; Interrogation_Position=623; Antisense; GCCTGGATCCCCAAAGCTTTGTGGA
>probe:Drosophila_2:1635897_at:515:267; Interrogation_Position=661; Antisense; CAGGGCAAACTGTACGGCTTCCTAA
>probe:Drosophila_2:1635897_at:452:279; Interrogation_Position=682; Antisense; CTAAACCGCGTCATCGAGTTCAAGG
>probe:Drosophila_2:1635897_at:622:139; Interrogation_Position=717; Antisense; ACTGTTAAGTTTCCGCCACTTGTGA

Paste this into a BLAST search page for me
TGAGTATTCCAAGCCGGTGATCCTGGAGGACTCCGAGAATTACCCGTATACACCACGAATATCCTGTACTTTGTCGCCAGCAGCGCGAAAGCTTCTATAAATCGTCCTCGTGTACAACATGCTGGTGCACGATTGGCTGTACGATCCGTTCTGCGCATCCGTTCCATATTGAAAAGGACAAGCTGATGCGACGACCACTGATTGCCCACCAGTTAAACGTCGAGGGAGATGCTCGTCAATTGCCTGGATCGCCTGGATCCCCAAAGCTTTGTGGACAGGGCAAACTGTACGGCTTCCTAACTAAACCGCGTCATCGAGTTCAAGGACTGTTAAGTTTCCGCCACTTGTGA

Full Affymetrix probeset data:

Annotations for 1635897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720