FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635898_at:

>probe:Drosophila_2:1635898_at:638:457; Interrogation_Position=1420; Antisense; GATATCGACTGAGCTAATGCCCACC
>probe:Drosophila_2:1635898_at:593:233; Interrogation_Position=1435; Antisense; AATGCCCACCTGTGTGAGATCCAGT
>probe:Drosophila_2:1635898_at:214:449; Interrogation_Position=1452; Antisense; GATCCAGTGGTTTGGCGGTAATTCA
>probe:Drosophila_2:1635898_at:23:495; Interrogation_Position=1469; Antisense; GTAATTCATGTCACCGCAGCAGCAT
>probe:Drosophila_2:1635898_at:418:5; Interrogation_Position=1492; Antisense; ATTGTCCTTCATTTCGCCATTTATA
>probe:Drosophila_2:1635898_at:492:729; Interrogation_Position=1523; Antisense; TTGGACACATATTTCCGGGCAGCAT
>probe:Drosophila_2:1635898_at:667:115; Interrogation_Position=1543; Antisense; AGCATCCTCGATCATTACCTGCATT
>probe:Drosophila_2:1635898_at:529:705; Interrogation_Position=1557; Antisense; TTACCTGCATTCTACTCCTAGTTAG
>probe:Drosophila_2:1635898_at:590:247; Interrogation_Position=1574; Antisense; CTAGTTAGCGCCTGGATTTGCCTGC
>probe:Drosophila_2:1635898_at:605:19; Interrogation_Position=1589; Antisense; ATTTGCCTGCTCCTGTCGGAGACGA
>probe:Drosophila_2:1635898_at:562:173; Interrogation_Position=1621; Antisense; AAAGCTGCCTTTAACATTAGCGGAG
>probe:Drosophila_2:1635898_at:45:77; Interrogation_Position=1662; Antisense; AGGGCGAGCGGATGTTCGACTTTAT
>probe:Drosophila_2:1635898_at:272:455; Interrogation_Position=1706; Antisense; GATCAACACGATCTCAGTGCTGACA
>probe:Drosophila_2:1635898_at:53:373; Interrogation_Position=1791; Antisense; GAAGGATTGTAGCTGCCTATTGCAT

Paste this into a BLAST search page for me
GATATCGACTGAGCTAATGCCCACCAATGCCCACCTGTGTGAGATCCAGTGATCCAGTGGTTTGGCGGTAATTCAGTAATTCATGTCACCGCAGCAGCATATTGTCCTTCATTTCGCCATTTATATTGGACACATATTTCCGGGCAGCATAGCATCCTCGATCATTACCTGCATTTTACCTGCATTCTACTCCTAGTTAGCTAGTTAGCGCCTGGATTTGCCTGCATTTGCCTGCTCCTGTCGGAGACGAAAAGCTGCCTTTAACATTAGCGGAGAGGGCGAGCGGATGTTCGACTTTATGATCAACACGATCTCAGTGCTGACAGAAGGATTGTAGCTGCCTATTGCAT

Full Affymetrix probeset data:

Annotations for 1635898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720