FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635900_at:

>probe:Drosophila_2:1635900_at:140:239; Interrogation_Position=184; Antisense; AATCAGCTAAGATGTCCGCTTCACC
>probe:Drosophila_2:1635900_at:101:625; Interrogation_Position=238; Antisense; TGCCCATGATCACCAGGAAGGTTGT
>probe:Drosophila_2:1635900_at:602:371; Interrogation_Position=254; Antisense; GAAGGTTGTCATCTCGGATCCGATC
>probe:Drosophila_2:1635900_at:55:47; Interrogation_Position=271; Antisense; ATCCGATCCAGATGCCCGAGGTGTA
>probe:Drosophila_2:1635900_at:524:143; Interrogation_Position=330; Antisense; ACTCCTGGAGGCACCAAACTTATCT
>probe:Drosophila_2:1635900_at:590:309; Interrogation_Position=343; Antisense; CCAAACTTATCTACGAGCGGGCTTT
>probe:Drosophila_2:1635900_at:683:697; Interrogation_Position=365; Antisense; TTTCATGAAGAATCTCCGTGGCTCC
>probe:Drosophila_2:1635900_at:625:197; Interrogation_Position=414; Antisense; AACGTGCCCAGTTGCTTGCTGAGGG
>probe:Drosophila_2:1635900_at:300:503; Interrogation_Position=474; Antisense; GTCCCCACGGAACTGATCAAGCAGA
>probe:Drosophila_2:1635900_at:305:311; Interrogation_Position=589; Antisense; CCAACTAGTTCTTAGATGCACCCAC
>probe:Drosophila_2:1635900_at:340:617; Interrogation_Position=605; Antisense; TGCACCCACTAAAACCGATCTTATA
>probe:Drosophila_2:1635900_at:570:451; Interrogation_Position=621; Antisense; GATCTTATAAGCTTAGTGTACCCAT
>probe:Drosophila_2:1635900_at:305:657; Interrogation_Position=657; Antisense; TAAGTTCTTAGTTCTTCCACCTTGT
>probe:Drosophila_2:1635900_at:481:723; Interrogation_Position=678; Antisense; TTGTTTGTTCTCTCGGTCATATTGA

Paste this into a BLAST search page for me
AATCAGCTAAGATGTCCGCTTCACCTGCCCATGATCACCAGGAAGGTTGTGAAGGTTGTCATCTCGGATCCGATCATCCGATCCAGATGCCCGAGGTGTAACTCCTGGAGGCACCAAACTTATCTCCAAACTTATCTACGAGCGGGCTTTTTTCATGAAGAATCTCCGTGGCTCCAACGTGCCCAGTTGCTTGCTGAGGGGTCCCCACGGAACTGATCAAGCAGACCAACTAGTTCTTAGATGCACCCACTGCACCCACTAAAACCGATCTTATAGATCTTATAAGCTTAGTGTACCCATTAAGTTCTTAGTTCTTCCACCTTGTTTGTTTGTTCTCTCGGTCATATTGA

Full Affymetrix probeset data:

Annotations for 1635900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720