Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635901_at:

>probe:Drosophila_2:1635901_at:712:143; Interrogation_Position=424; Antisense; ACTGCCAGTTGCGTCGGACACAATA
>probe:Drosophila_2:1635901_at:163:711; Interrogation_Position=469; Antisense; TTCACCCTCTTCATGGCTTTGGGAA
>probe:Drosophila_2:1635901_at:687:195; Interrogation_Position=492; Antisense; AACTGGTGTGGCCTTGGCTACCCAT
>probe:Drosophila_2:1635901_at:626:671; Interrogation_Position=510; Antisense; TACCCATATTATTGCCACCCTAAAG
>probe:Drosophila_2:1635901_at:69:483; Interrogation_Position=534; Antisense; GTATTTTAGCTATTCGGACCTGATA
>probe:Drosophila_2:1635901_at:147:455; Interrogation_Position=577; Antisense; GATAACTTACCTCCATTTTGGCTGG
>probe:Drosophila_2:1635901_at:314:583; Interrogation_Position=595; Antisense; TGGCTGGTCATCACTCTTATACTAA
>probe:Drosophila_2:1635901_at:398:663; Interrogation_Position=617; Antisense; TAAACACCTACGTATTTGCAGCCCC
>probe:Drosophila_2:1635901_at:482:305; Interrogation_Position=640; Antisense; CCTGTATCTTCGGTGCTTATGCAAT
>probe:Drosophila_2:1635901_at:684:25; Interrogation_Position=710; Antisense; ATACCTACGATCTGGGCTTGTGGGA
>probe:Drosophila_2:1635901_at:529:625; Interrogation_Position=803; Antisense; TGCCCCATGATGGTGCCCAGTGGAA
>probe:Drosophila_2:1635901_at:409:193; Interrogation_Position=876; Antisense; AACTGACATGATATACCACCTTTTG
>probe:Drosophila_2:1635901_at:435:25; Interrogation_Position=911; Antisense; ATAGTGTTCAGCATCATTCACCAAA
>probe:Drosophila_2:1635901_at:269:155; Interrogation_Position=939; Antisense; ACAGTTTCTCCGTGTATCCGATTGA

Paste this into a BLAST search page for me
ACTGCCAGTTGCGTCGGACACAATATTCACCCTCTTCATGGCTTTGGGAAAACTGGTGTGGCCTTGGCTACCCATTACCCATATTATTGCCACCCTAAAGGTATTTTAGCTATTCGGACCTGATAGATAACTTACCTCCATTTTGGCTGGTGGCTGGTCATCACTCTTATACTAATAAACACCTACGTATTTGCAGCCCCCCTGTATCTTCGGTGCTTATGCAATATACCTACGATCTGGGCTTGTGGGATGCCCCATGATGGTGCCCAGTGGAAAACTGACATGATATACCACCTTTTGATAGTGTTCAGCATCATTCACCAAAACAGTTTCTCCGTGTATCCGATTGA

Full Affymetrix probeset data:

Annotations for 1635901_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime