FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635903_at:

>probe:Drosophila_2:1635903_at:64:207; Interrogation_Position=4043; Antisense; AAGCTGGACCTCATGAGGCTGGGTC
>probe:Drosophila_2:1635903_at:520:623; Interrogation_Position=4068; Antisense; TGCGCGTTGGCATCGAAGTGCGTTT
>probe:Drosophila_2:1635903_at:415:211; Interrogation_Position=4110; Antisense; AAGAACGTGTGTGCACCTCGTCCGA
>probe:Drosophila_2:1635903_at:371:517; Interrogation_Position=4137; Antisense; GTGTGGACAGTCCACCAAGCACTTA
>probe:Drosophila_2:1635903_at:50:73; Interrogation_Position=4177; Antisense; AGGCAATAGCTCTTTTGCGCTTATT
>probe:Drosophila_2:1635903_at:562:89; Interrogation_Position=4287; Antisense; AGTACGATTCGTGCAGCGAGTGACT
>probe:Drosophila_2:1635903_at:52:209; Interrogation_Position=4320; Antisense; AAGCTTTCTGAGTTGTGCCTTTACA
>probe:Drosophila_2:1635903_at:282:61; Interrogation_Position=4375; Antisense; ATGTGCTACTAACCGCTGCGAGGCT
>probe:Drosophila_2:1635903_at:248:439; Interrogation_Position=4394; Antisense; GAGGCTCAGCTCAATGAGTCTCCAG
>probe:Drosophila_2:1635903_at:133:429; Interrogation_Position=4409; Antisense; GAGTCTCCAGCAGCCCTGGGTTAAG
>probe:Drosophila_2:1635903_at:243:475; Interrogation_Position=4428; Antisense; GTTAAGTTCTCCCATGCTGACTCAT
>probe:Drosophila_2:1635903_at:71:335; Interrogation_Position=4443; Antisense; GCTGACTCATGTCTTTTCAACTTTG
>probe:Drosophila_2:1635903_at:340:387; Interrogation_Position=4473; Antisense; GAAAAGGCGTTGTCTGTGTGTCCAG
>probe:Drosophila_2:1635903_at:634:517; Interrogation_Position=4488; Antisense; GTGTGTCCAGTTTTAACGATTGCAT

Paste this into a BLAST search page for me
AAGCTGGACCTCATGAGGCTGGGTCTGCGCGTTGGCATCGAAGTGCGTTTAAGAACGTGTGTGCACCTCGTCCGAGTGTGGACAGTCCACCAAGCACTTAAGGCAATAGCTCTTTTGCGCTTATTAGTACGATTCGTGCAGCGAGTGACTAAGCTTTCTGAGTTGTGCCTTTACAATGTGCTACTAACCGCTGCGAGGCTGAGGCTCAGCTCAATGAGTCTCCAGGAGTCTCCAGCAGCCCTGGGTTAAGGTTAAGTTCTCCCATGCTGACTCATGCTGACTCATGTCTTTTCAACTTTGGAAAAGGCGTTGTCTGTGTGTCCAGGTGTGTCCAGTTTTAACGATTGCAT

Full Affymetrix probeset data:

Annotations for 1635903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720