FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635907_at:

>probe:Drosophila_2:1635907_at:559:633; Interrogation_Position=1896; Antisense; TCCCAGACAGAAGTACCAGCCAGAT
>probe:Drosophila_2:1635907_at:556:487; Interrogation_Position=1908; Antisense; GTACCAGCCAGATAACGCTGCCGAT
>probe:Drosophila_2:1635907_at:2:455; Interrogation_Position=1930; Antisense; GATCAGCCACCGAATTCGTATGGAC
>probe:Drosophila_2:1635907_at:52:587; Interrogation_Position=1950; Antisense; TGGACAGGGTCATCCCAATGGCCAG
>probe:Drosophila_2:1635907_at:613:227; Interrogation_Position=1966; Antisense; AATGGCCAGCACATCAGCGATAAGG
>probe:Drosophila_2:1635907_at:439:359; Interrogation_Position=1994; Antisense; GCAAGATTCGCAGCGTCGCCAAGAA
>probe:Drosophila_2:1635907_at:448:377; Interrogation_Position=2101; Antisense; GAAGCACAGTACCTGGATGAGCTCA
>probe:Drosophila_2:1635907_at:74:547; Interrogation_Position=2115; Antisense; GGATGAGCTCAAGGCTCTCAAGCAG
>probe:Drosophila_2:1635907_at:40:207; Interrogation_Position=2134; Antisense; AAGCAGTCTGCCTAGGAGGACGTTA
>probe:Drosophila_2:1635907_at:204:551; Interrogation_Position=2205; Antisense; GGAGTAATTGCTCTTGTGATTGTGA
>probe:Drosophila_2:1635907_at:2:467; Interrogation_Position=2222; Antisense; GATTGTGATACAGCACCTCTTCTCA
>probe:Drosophila_2:1635907_at:136:705; Interrogation_Position=2294; Antisense; TTACGCTCAGTTTGTGGCCCATTTG
>probe:Drosophila_2:1635907_at:210:513; Interrogation_Position=2356; Antisense; GTGATTTCCCAACTAATTTCGGCAA
>probe:Drosophila_2:1635907_at:140:185; Interrogation_Position=2455; Antisense; AAAATCTGCGGATTACTGCTCCCAA

Paste this into a BLAST search page for me
TCCCAGACAGAAGTACCAGCCAGATGTACCAGCCAGATAACGCTGCCGATGATCAGCCACCGAATTCGTATGGACTGGACAGGGTCATCCCAATGGCCAGAATGGCCAGCACATCAGCGATAAGGGCAAGATTCGCAGCGTCGCCAAGAAGAAGCACAGTACCTGGATGAGCTCAGGATGAGCTCAAGGCTCTCAAGCAGAAGCAGTCTGCCTAGGAGGACGTTAGGAGTAATTGCTCTTGTGATTGTGAGATTGTGATACAGCACCTCTTCTCATTACGCTCAGTTTGTGGCCCATTTGGTGATTTCCCAACTAATTTCGGCAAAAAATCTGCGGATTACTGCTCCCAA

Full Affymetrix probeset data:

Annotations for 1635907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720