FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635910_at:

>probe:Drosophila_2:1635910_at:609:1; Interrogation_Position=2428; Antisense; ATTGGAGAGCTCATGTCACGTTTCA
>probe:Drosophila_2:1635910_at:495:493; Interrogation_Position=2442; Antisense; GTCACGTTTCAAAGTTTCCGATGCA
>probe:Drosophila_2:1635910_at:588:631; Interrogation_Position=2458; Antisense; TCCGATGCAGCAGTTTAGACCCTAG
>probe:Drosophila_2:1635910_at:369:209; Interrogation_Position=2499; Antisense; AAGCAAGTGACCCATGCAAATGCAT
>probe:Drosophila_2:1635910_at:217:483; Interrogation_Position=2566; Antisense; GTACTCGTCGCCTGTTTGTTTGTTT
>probe:Drosophila_2:1635910_at:326:479; Interrogation_Position=2591; Antisense; GTTTCTTTGTTCAAGTGCCTTTCGC
>probe:Drosophila_2:1635910_at:436:315; Interrogation_Position=2607; Antisense; GCCTTTCGCCTGCTTGTGAGTGAAA
>probe:Drosophila_2:1635910_at:482:77; Interrogation_Position=2688; Antisense; AGGTTTATTTCTGCCGGAAGTCAGC
>probe:Drosophila_2:1635910_at:534:383; Interrogation_Position=2719; Antisense; GAACTGTTCGATCTATGCAAATGCA
>probe:Drosophila_2:1635910_at:712:357; Interrogation_Position=2735; Antisense; GCAAATGCATATCCACTAATCGAAA
>probe:Drosophila_2:1635910_at:697:47; Interrogation_Position=2786; Antisense; ATCCTAACTTAGTTGGCACTGTCAG
>probe:Drosophila_2:1635910_at:497:419; Interrogation_Position=2822; Antisense; GAGCAGCTAGTGTTTTGTTTTGTCT
>probe:Drosophila_2:1635910_at:470:475; Interrogation_Position=2838; Antisense; GTTTTGTCTTTAATCGTTGGTCGCT
>probe:Drosophila_2:1635910_at:336:467; Interrogation_Position=2853; Antisense; GTTGGTCGCTCTTGCTTATTTATTT

Paste this into a BLAST search page for me
ATTGGAGAGCTCATGTCACGTTTCAGTCACGTTTCAAAGTTTCCGATGCATCCGATGCAGCAGTTTAGACCCTAGAAGCAAGTGACCCATGCAAATGCATGTACTCGTCGCCTGTTTGTTTGTTTGTTTCTTTGTTCAAGTGCCTTTCGCGCCTTTCGCCTGCTTGTGAGTGAAAAGGTTTATTTCTGCCGGAAGTCAGCGAACTGTTCGATCTATGCAAATGCAGCAAATGCATATCCACTAATCGAAAATCCTAACTTAGTTGGCACTGTCAGGAGCAGCTAGTGTTTTGTTTTGTCTGTTTTGTCTTTAATCGTTGGTCGCTGTTGGTCGCTCTTGCTTATTTATTT

Full Affymetrix probeset data:

Annotations for 1635910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720