FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635912_at:

>probe:Drosophila_2:1635912_at:7:87; Interrogation_Position=3484; Antisense; AGTGCGATGCATTGCTAATAAGCCA
>probe:Drosophila_2:1635912_at:349:27; Interrogation_Position=3525; Antisense; ATACTCTTGATACTTACTTAGCCGT
>probe:Drosophila_2:1635912_at:384:529; Interrogation_Position=3586; Antisense; GGGATAACTGGCCACAATGGGCCAT
>probe:Drosophila_2:1635912_at:11:589; Interrogation_Position=3618; Antisense; TGGTAGCCGCAGATGAATAAGTCTC
>probe:Drosophila_2:1635912_at:391:497; Interrogation_Position=3638; Antisense; GTCTCGGGCAGCATTTTAATTACTA
>probe:Drosophila_2:1635912_at:689:657; Interrogation_Position=3674; Antisense; TAAGCCATTGTTGCGACAAACTTGT
>probe:Drosophila_2:1635912_at:628:257; Interrogation_Position=3694; Antisense; CTTGTATATTTCCTTCACTACGTGA
>probe:Drosophila_2:1635912_at:202:289; Interrogation_Position=3714; Antisense; CGTGAACGAACAATGGACCCTGCTA
>probe:Drosophila_2:1635912_at:197:555; Interrogation_Position=3728; Antisense; GGACCCTGCTATTTGTAATTGTGCT
>probe:Drosophila_2:1635912_at:414:29; Interrogation_Position=3773; Antisense; ATACTTACTAAGACGACTCGCAGTG
>probe:Drosophila_2:1635912_at:124:245; Interrogation_Position=3865; Antisense; AATTTTGTGTGTGCATTGTGTGTTT
>probe:Drosophila_2:1635912_at:470:517; Interrogation_Position=3894; Antisense; GTGTGTTTCACTTAAGCAGCTTGTA
>probe:Drosophila_2:1635912_at:250:493; Interrogation_Position=3938; Antisense; GTAATTGTTTGACATGCAGTACCTA
>probe:Drosophila_2:1635912_at:577:269; Interrogation_Position=3950; Antisense; CATGCAGTACCTATTGTTTTTGTTA

Paste this into a BLAST search page for me
AGTGCGATGCATTGCTAATAAGCCAATACTCTTGATACTTACTTAGCCGTGGGATAACTGGCCACAATGGGCCATTGGTAGCCGCAGATGAATAAGTCTCGTCTCGGGCAGCATTTTAATTACTATAAGCCATTGTTGCGACAAACTTGTCTTGTATATTTCCTTCACTACGTGACGTGAACGAACAATGGACCCTGCTAGGACCCTGCTATTTGTAATTGTGCTATACTTACTAAGACGACTCGCAGTGAATTTTGTGTGTGCATTGTGTGTTTGTGTGTTTCACTTAAGCAGCTTGTAGTAATTGTTTGACATGCAGTACCTACATGCAGTACCTATTGTTTTTGTTA

Full Affymetrix probeset data:

Annotations for 1635912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720