FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635914_at:

>probe:Drosophila_2:1635914_at:612:243; Interrogation_Position=3226; Antisense; AATATTATACCAACTGCATCGCCTC
>probe:Drosophila_2:1635914_at:94:619; Interrogation_Position=3240; Antisense; TGCATCGCCTCACCCTATAAAAGTA
>probe:Drosophila_2:1635914_at:684:241; Interrogation_Position=3305; Antisense; AATATTTATTCGCACAGACCCACAA
>probe:Drosophila_2:1635914_at:44:237; Interrogation_Position=3393; Antisense; AATCGAACACACGTGGACCATCCAG
>probe:Drosophila_2:1635914_at:572:519; Interrogation_Position=3405; Antisense; GTGGACCATCCAGCAATTGATAAAT
>probe:Drosophila_2:1635914_at:189:37; Interrogation_Position=3433; Antisense; ATCATATTCAAAACTCATCCCCAAC
>probe:Drosophila_2:1635914_at:77:383; Interrogation_Position=3459; Antisense; GAACTCACACCGATATTAACCTCTT
>probe:Drosophila_2:1635914_at:291:455; Interrogation_Position=3552; Antisense; GATAACCGCGTTCCATTGTGGTTGT
>probe:Drosophila_2:1635914_at:562:441; Interrogation_Position=3583; Antisense; GATGATTTCATATTGCACTTAGTTT
>probe:Drosophila_2:1635914_at:272:355; Interrogation_Position=3597; Antisense; GCACTTAGTTTGTAATCCATTTTTG
>probe:Drosophila_2:1635914_at:550:727; Interrogation_Position=3619; Antisense; TTGGAAGACCTTCACAGCTCGGACG
>probe:Drosophila_2:1635914_at:388:263; Interrogation_Position=3633; Antisense; CAGCTCGGACGGACATTGATCGATT
>probe:Drosophila_2:1635914_at:513:275; Interrogation_Position=3687; Antisense; CTTTATGGAACTGTGACCTAGCTAA
>probe:Drosophila_2:1635914_at:683:343; Interrogation_Position=3732; Antisense; GCATTCATTGTAATCGGTTCTTTCC

Paste this into a BLAST search page for me
AATATTATACCAACTGCATCGCCTCTGCATCGCCTCACCCTATAAAAGTAAATATTTATTCGCACAGACCCACAAAATCGAACACACGTGGACCATCCAGGTGGACCATCCAGCAATTGATAAATATCATATTCAAAACTCATCCCCAACGAACTCACACCGATATTAACCTCTTGATAACCGCGTTCCATTGTGGTTGTGATGATTTCATATTGCACTTAGTTTGCACTTAGTTTGTAATCCATTTTTGTTGGAAGACCTTCACAGCTCGGACGCAGCTCGGACGGACATTGATCGATTCTTTATGGAACTGTGACCTAGCTAAGCATTCATTGTAATCGGTTCTTTCC

Full Affymetrix probeset data:

Annotations for 1635914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720