FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635915_at:

>probe:Drosophila_2:1635915_at:108:675; Interrogation_Position=169; Antisense; TATCGGAGTGCCCATTAAAGTTCTG
>probe:Drosophila_2:1635915_at:484:705; Interrogation_Position=183; Antisense; TTAAAGTTCTGCACGAGGCCGAGGG
>probe:Drosophila_2:1635915_at:524:69; Interrogation_Position=198; Antisense; AGGCCGAGGGCCACATAATCACTTG
>probe:Drosophila_2:1635915_at:316:655; Interrogation_Position=213; Antisense; TAATCACTTGCGAAACCATCACCGG
>probe:Drosophila_2:1635915_at:288:533; Interrogation_Position=241; Antisense; GGTGTACCGCGGCAAACTCATCGAG
>probe:Drosophila_2:1635915_at:529:451; Interrogation_Position=298; Antisense; GATCACGGTGACCTACCGAGACGGA
>probe:Drosophila_2:1635915_at:259:587; Interrogation_Position=336; Antisense; TGGAGAACGTCTACATTCGCGGCTC
>probe:Drosophila_2:1635915_at:393:627; Interrogation_Position=359; Antisense; TCCAAGATCCGATTCCTTATACTGC
>probe:Drosophila_2:1635915_at:38:277; Interrogation_Position=374; Antisense; CTTATACTGCCCGACATGCTGAAAA
>probe:Drosophila_2:1635915_at:608:179; Interrogation_Position=395; Antisense; AAAAATGCCCCGATGTTCAAGAAGC
>probe:Drosophila_2:1635915_at:544:561; Interrogation_Position=619; Antisense; GGAACTGCCTACTGAACAACGCATT
>probe:Drosophila_2:1635915_at:621:469; Interrogation_Position=656; Antisense; GTTGCGGGCATCATATTATTAGCGG
>probe:Drosophila_2:1635915_at:628:527; Interrogation_Position=683; Antisense; GGGTCGAACTTCTCCAGATGTTTTT
>probe:Drosophila_2:1635915_at:341:567; Interrogation_Position=724; Antisense; GGCAGAGCAGCCGAGAATACACTTG

Paste this into a BLAST search page for me
TATCGGAGTGCCCATTAAAGTTCTGTTAAAGTTCTGCACGAGGCCGAGGGAGGCCGAGGGCCACATAATCACTTGTAATCACTTGCGAAACCATCACCGGGGTGTACCGCGGCAAACTCATCGAGGATCACGGTGACCTACCGAGACGGATGGAGAACGTCTACATTCGCGGCTCTCCAAGATCCGATTCCTTATACTGCCTTATACTGCCCGACATGCTGAAAAAAAAATGCCCCGATGTTCAAGAAGCGGAACTGCCTACTGAACAACGCATTGTTGCGGGCATCATATTATTAGCGGGGGTCGAACTTCTCCAGATGTTTTTGGCAGAGCAGCCGAGAATACACTTG

Full Affymetrix probeset data:

Annotations for 1635915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720